The largest database of trusted experimental protocols

7 protocols using dsred rab7

1

Plasmid Transfection in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
DsRed-Rab5, DsRed-Rab7 and Flag-Rubicon plasmids were from Addgene. DsRed-LC3 plasmids were prepared in our laboratory. KSHV Flag-vBcl-2 plasmid was kindly provided by Professor Beth Levine, University of Texas Southwestern Medical Center. All plasmid constructs were confirmed by DNA sequencing. Cells were transiently transfected with the plasmids using lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions.
+ Open protocol
+ Expand
2

Reagents and Antibodies for Cell Biology

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following reagents
and antibodies were purchased from commercial sources: Antibodies
against β-actin HRP (sc-4777), CTSL (sc-32320), GAPDH (sc-47724
HRP), normal mouse IgG (sc-2025), normal rabbit IgG (sc-2027) along
with Protein A/G PLUS-Agarose beads (sc-2003) were purchased from
Santa Cruz. Antibodies against LC3 (Cat. #12741) and Streptavidin-HRP
(Cat. #3999) were purchased from Cell Signaling Technology. Antibodies
against PSAP (A1819) and NPC2 (A5413) were purchased from Abclonal.
Protease inhibitor cocktail was purchased from Sigma-Aldrich (Cat.
P8340). Streptavidin beads, ECL Western blotting detection reagent,
and Pierce Universal nuclease were purchased from ThermoScientific.
ClarityMax Western blotting detection reagent was purchased from BioRad
(Cat. 1705062). Polyethylenimine (PEI) was purchased from Polysciences
(Cat. 4765). Inhibitors used were all purchased as follows: Bafilomycin
from CST (Cat. 54645), chloroquine diphosphate from TCI (C2301), ammonium
chloride from Fisher Scientific (A661), E64d from SeleckChem (S7393),
and Pepstatin A from Sigma (P5318). BCA assay was used for protein
concentrations. Expression plasmids for organelle markers were all
purchased from Addgene: mCherry-Sec61 (#49155), dsRed-Rab5 (#13050),
mCherry-Rab11 (#55124), dsRed-Rab7 (#12661), and Lamp1-RFP (#1817).40 (link)−43 (link)
+ Open protocol
+ Expand
3

CRISPR/Cas9 Editing of TRAC Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following expression plasmids were obtained from Addgene: tf-LC3, EGFP-LC3 (#11546), mRFP-LC3 (#21075), GFP-Rab5B (#61802), EGFP-Rab6A (#49469), GFP-Rab7 (#12605), dsRed-Rab7 (#12661), dsRed-Rab11 (12679), LAMP1-RFP (#1817), mCherry-LAMP1 (#45147), mCherry-Atg5 (#13095), mCherry-p62(#55132), EGFP-Vamp7 (#42316), pEGFP-N1, and plasmids for the Sleeping Beauty transposon system, pCMV(CAT)T7-SB100 (#34879) and pSBbiGP (#60511). Plasmids for CRISPR/Cas9-mediated editing of TRAC, including pAP368 (to express TRAC gRNA-1 and EGFP reporter gene), pAP369 (to express TRAC gRNA-2 and EGFP reporter gene), and pAP370 (to express SpCas9) were obtained from Dr. Charles Gersbach’s laboratory. sgRNAs targeting TRAC were purchased from IDT; the sgRNA sequences were: AGAGTCTCTCAGCTGGTACA (sgRNA-1) and TGTGCTAGACATGAGGTCTA (sgRNA-2). PCR primers used in sequencing TRAC were TTGCTGGGGTTTTGAAGAAG (forward) and GGTTTTGGTGGCAATGGATA (reverse).
+ Open protocol
+ Expand
4

Fluorescent Plasmid-based Autophagy Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The EGFP-LC3 and DsRed-LC3 plasmids were created in our laboratory. The DsRed-Rab5, DsRed-Rab7 and Flag-Rubicon plasmids were purchased from Addgene. The KSHV Flag-vBcl-2 plasmid was kindly provided by Professor Beth Levine from the University of Texas Department of Medicine. The Rab1-37 genes in the T Vector were from Professor Jiahuai Han's Lab and sub-cloned into EGFP-C1 and DsRed-C1, respectively. All plasmids were confirmed by automated DNA sequencing. Cells were transiently transfected with the plasmids using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.
+ Open protocol
+ Expand
5

Fluorescent Protein-Tagged LC3 Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The EGFP-LC3 and DsRed-LC3 plasmids were created in our laboratory. The DsRed-Rab7 and DsRed-Rab34 were from Addgene (Cambridge, MA). All plasmids were confirmed by automated DNA sequencing. Cells were transfected with the plasmids using Lipofectamine 2000 according to the manufacturer’s instructions.
MCF-7 cells (20,000 cells/well, 12-well plate) were seeded the day before adding the protein nanocapsules. Before the experiment, the medium was then replaced with 0.4 mL of fresh medium. After that, 50 nM FITC-labeled nanocapsules were added into cell medium and incubated at 37 °C for 12 h.
+ Open protocol
+ Expand
6

Cloning and Characterization of KIF5B Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Full-length cDNA of KIF5B was cloned into a HA-, GFP-, and FLAG-tagged expression vector, pXJ40 (E. Manser, Institute of Molecular and Cell Biology, Singapore). Constructions used in the cellular localization study were DsRed-ER (Clontech), pEYFP-Golgi (#6909-1; Clontech), mRFP-Rab5 (Vonderheit and Helenius, 2005 ; #14437; Addgene), and DsRed-Rab7 (Choudhury et al., 2002 (link); #12661; Addgene). Deletion mutants were generated by PCR using specific primers facilitated by restriction sites. For each construct, several clones were chosen and sequenced to entirety in both directions to confirm their identity. All plasmids were purified using Axygen miniprep kit for use in transfection experiments. E. coli strain DH5α was used as host for propagation of the clones.
+ Open protocol
+ Expand
7

Dual-Fluorescent Protein Plasmid Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols
DsRed-Rab5 and DsRed-Rab7 were obtained from Addgene. KSHV Flag-vBcl-2 plasmid was kindly provided by Professor Beth Levine from Department of Medicine, University of Texas. Rab family genes in the T Vector and sub-cloned into EGFP-C1 and DsRed-C1 were kindly provided by Professor Jiahuai Han’s Lab. All the plasmids were confirmed by automated DNA sequencing. And cells were transfected with the plasmids by Lipofectamine 2000 (Invitrogen).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!