Sigenome non targeting sirna

Manufactured by Horizon Discovery

Sourced in United States, Germany

The SiGENOME Non-Targeting siRNA is a laboratory product designed for use in RNA interference (RNAi) experiments. It is a pool of several small interfering RNA (siRNA) duplexes that do not target any known genes in a given organism. This product is intended to serve as a control in RNAi studies to help researchers evaluate the specificity of their gene silencing experiments.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine rnaimax, by Thermo Fisher Scientific (8 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (7 mentions) Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (4 mentions) Sigenome smartpool sirna, by Horizon Discovery (3 mentions) Sigenome sirna smartpool reagents, by Horizon Discovery (2 mentions) Sidesign center, by Horizon Discovery (2 mentions) Sirna, by Horizon Discovery (2 mentions) Sigenome mouse siesr1, by Horizon Discovery (2 mentions) Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions) Rnaimax, by Thermo Fisher Scientific (2 mentions) Rnaimax transfection reagent, by Thermo Fisher Scientific (1 mentions) Shrna plasmids, by Merck Group (1 mentions) Hiperfect, by Qiagen (1 mentions) 4d nucleofector system, by Lonza (1 mentions) Lipofectamine 2000 transfect reagent, by Thermo Fisher Scientific (1 mentions) On targetplus, by Horizon Discovery (1 mentions) Amaxa cell line nucleofector kit 5, by Lonza (1 mentions) Nucleofector 2 device, by Lonza (1 mentions) Entinostat, by Selleck Chemicals (1 mentions) Bxpc 3, by Thermo Fisher Scientific (1 mentions)

28 protocols using sigenome non targeting sirna

Transfecting siRNA and Plasmid DNA in RPE-1 and HeLa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

ON-TARGETplus Human WAPL siRNA-SMARTpool (Dharmacon, 23063) were transfected into RPE-1 or HeLa cells using the RNAiMAX transfection reagent (Thermofisher 13778030). 20μM siRNAs aliquots were incubated with transfection agent in Optimem medium at room temperature for 20 minutes and added to cells grown in medium without antibiotics. siGENOME non-targeting siRNA (Dharmacon, D-001210) was transfected in parallel as a negative control. The effects of siRNAs were evaluated 48 hours after transfection.
Plasmid DNA transfection was performed in all cases using the Lipofectamine 3000 reagent (Thermofisher, L3000001). DNA (2.5-5 μg) and transfection reagent were incubated in Optimem medium at room temperature for 20 minutes and then added to the cell medium. The expression of transfected DNA was analyzed 48-72 hours after transfection.

Perea-Resa C., Bury L., Cheeseman I.M, & Blower M.D. (2020). Cohesin removal reprograms gene expression upon mitotic entry. Molecular cell, 78(1), 127-140.e7.

+ Open protocol

+ Expand

Modulation of TPD54 Expression in Breast Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Specific siGENOME siRNA SMARTpool® reagents against TPD54 as well as a negative control, siGENOME Non-Targeting siRNA, were purchased from Dharmacon Inc. (Lafayette, CO, USA). Detailed sequence information was provided in Additional file 1: Supplementary Materials and Methods. MCF-7 cells were transiently transfected with negative control or TPD54 siRNAs for 24 h using Lipofectamine RNAimax. Cells were then treated with metformin at different concentrations for 48 h.
shRNA plasmids (shTRC2 control and shTPD54 shRNA plasmids) were purchased from Sigma-Aldrich. MCF-7 cells were transfected with shRNA plasmids using the Lipofectamine 2000 transfection reagents. Transfected cells were then incubated in the presence of puromycin at 2 μg/mL for 2 weeks to generate stably transfected cells. Single colonies with low TPD54 expression were then selected for further downstream experiments.
TPD54 (NM_199359.2) was overexpressed in MCF-7 cells and patient-derived xenografts using lipofectamine 2000. Cells were treated as indicated after transfection for 1 day.

Zhuang Y., Ly R.C., Frazier C.V., Yu J., Qin S., Fan X.Y., Goetz M.P., Boughey J.C., Weinshilboum R, & Wang L. (2019). The novel function of tumor protein D54 in regulating pyruvate dehydrogenase and metformin cytotoxicity in breast cancer. Cancer & Metabolism, 7, 1.

+ Open protocol

+ Expand

Silencing of MRP1, p53, and xCT in HCT116 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HCT116 cells (2.5 × 10⁵) were plated in 6‐well plates and transfected with 10 nM siRNA 6–8 h later using HiPerfect (Qiagen, Germany) according to the manufacturer’s protocol. AllStars Negative Control siRNA (Qiagen, Germany) and siGENOME Non‐Targeting siRNA (Dharmacon, USA) were used as negative controls. ABCC1 (MRP1), TP53, and SLC7A11 (xCT) were silenced using four, two, and three different siRNA sequences, respectively (additional details are included in Appendix Table S6). To evaluate the siRNA knockdown efficiency, MRP1, xCT, and p53 protein levels were assessed by Western blotting 24 h after transfection.

Ceder S., Eriksson S.E., Cheteh E.H., Dawar S., Corrales Benitez M., Bykov V.J., Fujihara K.M., Grandin M., Li X., Ramm S., Behrenbruch C., Simpson K.J., Hollande F., Abrahmsen L., Clemons N.J, & Wiman K.G. (2020). A thiol‐bound drug reservoir enhances APR‐246‐induced mutant p53 tumor cell death. EMBO Molecular Medicine, 13(2), e10852.

+ Open protocol

+ Expand

Modulating TFH-like Cell Fate

Check if the same lab product or an alternative is used in the 5 most similar protocols

Day 5 primary murine T_FH-like cells were nucleofected with siGENOMESMARTpool siRNA (Dharmacon, D-051247, D-064214) targeting Ikzf1, Ikzf3, or both, using the Lonza 4D nucleofector system and buffer P3 per the manufacturer's instructions. siGENOME non-targeting siRNA was used as a control (Dharmacon, D-001210-01). Following nucleofection, cells recovered in T_H1-polarizing conditions containing low IL-2 (T_FH-like polarizing conditions) for 48h. RNA was isolated and changes in gene expression were analyzed via qRT-PCR, including Ikzf1 and Ikzf3 to establish knockdown efficiency.

Read K.A., Powell M.D., Baker C.E., Sreekumar B.K., Ringel-Scaia V.M., Bachus H., Martin R.E., Cooley I.D., Allen I.C., Ballesteros-Tato A, & Oestreich K.J. (2017). Integrated STAT3 and Ikaros Zinc Finger transcription factor activities regulate Bcl-6 expression in CD4+ T helper cells. Journal of immunology (Baltimore, Md. : 1950), 199(7), 2377-2387.

+ Open protocol

+ Expand

Investigating IP3R-mediated calcium regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

MCF-7, MDA MB-231 and MCF 10A cells (2×10⁶) were seeded in 6-well plates and treated with either vehicle (Control) or 25 μM XeC (inhibitor of IP3R mediated calcium release) (Cayman) in calcium free medium (EGTA pretreatment,1mM,was given to chelate extracellular calcium) for 48 hours. MCF-7, MDA MB-231 and MCF 10A cells were transfected using Lipofectamine 2000 transfect reagent (Invitrogen, USA) as per the manufacturer's protocol. Briefly, 2×10⁶cells were transfected with 4μg siRNA directed against the human IP3R2 or IP3R3 mRNA sequence (ON-TARGET plus, Dharmacon, USA) or control siRNA (siGENOME non-targeting siRNA; Dharmacon, USA) for 72 hours and further analyses were performed.

Singh A., Sharma R.K., Chagtoo M., Agarwal G., George N., Sinha N, & Godbole M.M. (2017). 1H NMR Metabolomics Reveals Association of High Expression of Inositol 1, 4, 5 Trisphosphate Receptor and Metabolites in Breast Cancer Patients. PLoS ONE, 12(1), e0169330.

+ Open protocol

+ Expand

Targeted Gene Silencing via shRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Synthetic oligo shRNAs for the targeted genes were cloned into the retroviral shRNA expression pLMP vector. The following shRNA target sequences were used.
shDram1: AAGAGTTCCTAGTAGTTCAAT; shUlk1: GGGUGGACACAUGCUAAUA; and shLuciferase: ACAAACGCCCTGATCGACAAG.
The siRNA sequences used were as follows: mouse Dram1 5'- AAGAGTTCCTAGTAGTTCAAT -3' and control siRNA (Dharmacon siGENOME Non-Targeting siRNA).

Nagata M., Arakawa S., Yamaguchi H., Torii S., Endo H., Tsujioka M., Honda S., Nishida Y., Konishi A, & Shimizu S. (2018). Dram1 regulates DNA damage-induced alternative autophagy. Cell Stress, 2(3), 55-65.

+ Open protocol

+ Expand

Silencing Y-RNA-1 in Human MSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

siRNA against Y-RNA-1 was designed using siDESIGN center (Dharmacon, Lafayette, CO). siRNAs against Y-RNA-1 (Y-RNA-1 siRNA; UUAUCUCAAUUGAUUGUUCACUU) or non-targeting (NT) control siRNA (siGENOME non-targeting siRNA) were purchased from Dharmacon. Transfection of human MSC was performed using Amaxa™ cell line nucleofector™ Kit V (Lonza). Cells were suspended in Nucleofector™ to a final concentration of 5 × 10⁵ cells/100 μl, and then transfected with either 50 nM and 100 nM of Y RNA1-siRNA or 2 μg GFP plasmid using the Nucleofector™ II Device (Lonza). After electroporation, cells were recovered by adding 500 μl media without antibiotics into the cuvette and then plated onto a six-well cell culture plate. After 6 hour, the media was replaced with media containing antibiotics.

Haga H., Yan I.K., Takahashi K., Matsuda A, & Patel T. (2017). Extracellular Vesicles from Bone Marrow‐Derived Mesenchymal Stem Cells Improve Survival from Lethal Hepatic Failure in Mice. Stem Cells Translational Medicine, 6(4), 1262-1272.

+ Open protocol

+ Expand

Cell Culture Conditions and Experimental Treatments

Check if the same lab product or an alternative is used in the 5 most similar protocols

L3.6, BxPC3 and Panc1 cells were purchased from ATCC (Manassas, VA, USA) and cultured in their respective growth media supplemented with 10% fetal bovine serum (Sigma), 1× Pen/Strep (Sigma) at 37°C under 5% CO₂. L3.6 cells were grown in phenol red-free Minimum Essential Medium Eagle (MEM; Invitrogen) containing 1× l-glutamine, BxPC3 cells in phenol red-containing Roswell Park Memorial Institute (RPMI; Invitrogen) 1640 medium and Panc1 cells in phenol red-free Dulbecco's modified Eagle's medium/F-12 (DMEM/F-12; Invitrogen) growth medium. The authenticity of all cell lines used in this study was authenticated by DNA profiling using eight different and highly polymorphic short tandem repeat (STR) loci. Cells were treated with 4SC-202 (1 μM), mocetinostat (500 nM, Selleckchem), entinostat (500 nM, Selleckchem), JQ1 (250 nM) or DMSO (vehicle) for 24 or 72 h and TGFβ (5 ng/ml; R&D systems) for 72 h as indicated. siRNA transfections were performed using Lipofectamine^® RNAiMAX (Invitrogen) according to the manufacturer's instructions. SmartPool^® siRNA against MYC (Dharmacon) contained the following sequences: 5΄-AACGUUAGCUUCACCAACA-3΄, 5΄-GGAACUAUGACCUCGACUA-3΄, 5΄-GAACACACAACGUCUUGGA-3΄, 5΄-CUACCAGGCUGCGCGCAAA-3΄. siGENOME non-targeting siRNA (Dharmacon; D-001206-13) was used as a negative control.

Mishra V.K., Wegwitz F., Kosinsky R.L., Sen M., Baumgartner R., Wulff T., Siveke J.T., Schildhaus H.U., Najafova Z., Kari V., Kohlhof H., Hessmann E, & Johnsen S.A. (2017). Histone deacetylase class-I inhibition promotes epithelial gene expression in pancreatic cancer cells in a BRD4- and MYC-dependent manner. Nucleic Acids Research, 45(11), 6334-6349.

+ Open protocol

+ Expand

siRNA-Mediated Depletion of Cell Cycle Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols

Synthetic siRNA oligonucleotides were obtained from Dharmacon‐GE Healthcare (Lafayette). The siRNA sequences were 5′‐CUGGUAGUACUAGUUCACCUA‐3′ (Plk4 siRNA), 5′‐GGCUUUAACUAAUUAUGGA‐3′ (PCM1 siRNA) or 5′‐GCACGUUAAUCAGCUACAAUU‐3′ (hSAS‐6 siRNA). Control depletion was carried out using siGENOME non‐targeting siRNA (Dharmacon). For RNAi experiments, cells were transfected with 40 nM of dsRNA using Lipofectamine RNAi‐MAX (Invitrogen), and cells were fixed 48 h after siRNA treatment unless otherwise stated.

Hori A., Barnouin K., Snijders A.P, & Toda T. (2016). A non‐canonical function of Plk4 in centriolar satellite integrity and ciliogenesis through PCM1 phosphorylation. EMBO Reports, 17(3), 326-337.

+ Open protocol

+ Expand

Silencing linc-RoR with siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two different siRNA against linc-RoR (5′ to 3′); siRNA linc-ROR-1: GGAGAGGAAGCCTGAGAGT, and siRNA linc-ROR-2: GGTTAAAGACACA-GGGGAA as well as a non-targeting (NT) control siRNA (siGENOME Non-Targeting siRNA) were purchased from Dharmacon (Lafayette, CO). Validated siRNA to p53 siRNA were obtained from Life Technologies (Grand Island, NY). Cell transfections were performed using 50–100 nM siRNA using Lipofectamine 2000 (Life Technologies, Grand Island, NY).

Takahashi K., Yan I.K., Kogure T., Haga H, & Patel T. (2014). Extracellular vesicle-mediated transfer of long non-coding RNA ROR modulates chemosensitivity in human hepatocellular cancer. FEBS Open Bio, 4, 458-467.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!