A Morpholino antisense oligo designed to recognise the 5′-UTR of securin (sequence: GATAAGAGTAGCCATTCTGGATTAC; MO; Gene Tools) was used to knock down gene expression. As per the manufacturer’s instructions, the oligo was stored at room temperature, heated for 5 minutes at 65°C prior to use, and loaded at a micropipette concentration of 1 mM.
Morpholino antisense oligo
Manufactured by Gene Tools
Sourced in United States
Morpholino antisense oligos are a type of laboratory equipment used in molecular biology and genetics research. They are synthetic oligonucleotides designed to interfere with gene expression by binding to complementary RNA sequences, inhibiting translation or splicing. Morpholinos are known for their stability, specificity, and ability to effectively modulate gene function in various experimental systems.
Automatically generated - may contain errors
10 protocols using morpholino antisense oligo
1
Securin Gene Expression Knockdown
2
Zebrafish smyhc1 Knockdown Using Morpholino
3
Knockdown of smyd1 genes in zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Morpholino antisense oligos were synthesized by Gene Tools. The smyd1b ATG-MO was based on the target sequence surrounding the ATG start codon. The two smyd1a splicing blockers (E8I8-MO, E9I9-MO) were based on the sequence at the exon-8/intron-8 or exon-9/intron-9 junction, respectively. The standard control MO from Gene Tools was used as control.
smyd1b ATG-MO: 5′ - ACTTCCACAAACTCCATTCTGGATC-3′.
smyd1a E8I8-MO: 5′ - ATATCGCAACACTCACATGTATCCA-3′.
smyd1a E9I9-MO: 5′ - GGTTGTACCTCCAGGTCTCTGCTGA-3′.
smyd1b ATG-MO: 5′ - ACTTCCACAAACTCCATTCTGGATC-3′.
smyd1a E8I8-MO: 5′ - ATATCGCAACACTCACATGTATCCA-3′.
smyd1a E9I9-MO: 5′ - GGTTGTACCTCCAGGTCTCTGCTGA-3′.
4
Morpholino Oligos for Apoc1 Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Morpholino antisense oligos were synthesized by Gene Tools, LLC (USA). To design the Apoc1 translation blocking morpholino (tbMO), sequences of more than 50 EST clones were compared to identify a suitable conserved sequence in the five prime untranslated region. To design the apoc1 splice blocking MO (spMO), genomic DNA was amplified by PCR with the primer for exon 1 and 3, and several clones were sequenced, and the spMO was designed against the exon2-intron2 boundary. The sequences of the MOs are; tbMO: 5'-GGG CAC CTT CTT TAG AAA GCT CTG A-3', spMO: 5'-GTC AGG AAA AGA TAC TGT ACC TTG T-3', control MO: 5'-CCT CTT ACC TCA GTT ACA ATT TAT A-3'. The Gbx2.2 MO sequence has previously been reported (Li et al., 2009) . To test the efficiency of the tbMO, western blots were performed with a 5'UTR apoc1-flag construct described further below.
5
Morpholino-mediated Knockdown of PDK Isoforms in Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Morpholino antisense oligos (Gene Tools) were designed to block translation of zebrafish isoforms of PDK by interfering with ribosome binding to the translation start site. The sequences of the ATG-targeted morpholinos were AAGTCCTGAAGATCCTCATGTTGGC (PDK1) and CTAACAAACTTCATCTTGGAAAGCT (PDK2a). The morpholinos were resuspended in sterile water to a concentration of 1 mM. After further dilution in Danieau’s solution (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO4, 0.6 mM Ca(NO3)2, 5 mM HEPES) to the desired concentration, 1 nl was injected into fertilized eggs at the single cell stage using an Eppendorff FemtoJet. After injection, the embryos were kept at 28°C in E3 solution.
6
Targeting medaka dazl mRNA with Morpholinos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Morpholino antisense oligos were purchased from Gene Tools (Oregon) and dissolved in water. MOdaz1 (TACTTCTGGGTCTGTTCAGATCCAT ) and MOdaz2 (TAAAACCAAGAATTTGGCCAGAAAC) target the medaka dazl RNA (Accession number AY973274), the former spans the initiation codon (underlined), and latter is positioned 12 nt upstream of the initiation codon.
7
Morpholino-based Gene Knockdown in Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Morpholino antisense oligos (Gene Tools, USA) were synthesized. The translation blocker (ATG-MO) was based on a sequence near the ATG (in bold) start site. The splicing blocker (E2I2-MO) was based on the sequence at the exon 2 and intron 2 junctions: ATG-MO: 5'-GGTTTTCTGCTTAATAT-CATCATGG -3'; and E2I2-MO: 5'-GAACAGGAAGTCGGACTTACAGTGT -3'. Besides, a standard control MO (CMO): 5'-CCTCTTACCTCAGTTA-CAATTTATA-3' were used as control. Morpholino antisense oligos were dissolved in 1X Danieau buffer to a final concentration of 1 mM. Next, 1-2 nl (5-10 ng) was injected into each embryo. The specificity and efficacy of each of these MO sequences have been confirmed as reported previously (Tan et al., 2006) .
8
Analyzing Zebrafish Cardiac Function
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AB wild-type and Tg(myl7:GFP) transgenic strains were purchased from the Institute of Hydrobiology, Chinese Academy of Sciences and maintained in Zebrafish Aquatic Housing Systems (Shanghai Haisheng Biotech, Shanghai, China) at 28 °C, pH 7.0–8.0, 0.25% salinity, and a light-dark cycle 14L:10D.
Morpholino antisense oligos targeting zebrafish CNPase mRNA were designed and synthesized (Gene Tools, LLC, Eugene, OR, USA). Embryos were injected (1 ng) at the one-cell stage by using an ASI pressure injection apparatus (Applied Scientific Instrumentation, Eugene, OR, USA). MO-injected embryos were grown in a 10-cm dish containing Holtfreter’s solution at 28 °C. The survival curve was plotted using a Kaplan–Meier Survival Curve.
Heart function was analyzed with fluorescence microscopy (ZEISS Axio Observer for Life Science Research, Jena, Germany). Zebrafish larvae (4 dpf) were anesthetized in 0.03% tricaine and mounted on 3% methylcellulose. Videos were recorded (15 s, repeated three times, 488 nm excitation wavelength) and processed using Adobe Bridge CC 2020 and Adobe Premiere Pro V8.1.0.7 software. The width and length of the ventricules were measured at the end of diastole and systole to obtain cardiac dimensions, based on which the heart function parameters were obtained [27 (link)].
Morpholino antisense oligos targeting zebrafish CNPase mRNA were designed and synthesized (Gene Tools, LLC, Eugene, OR, USA). Embryos were injected (1 ng) at the one-cell stage by using an ASI pressure injection apparatus (Applied Scientific Instrumentation, Eugene, OR, USA). MO-injected embryos were grown in a 10-cm dish containing Holtfreter’s solution at 28 °C. The survival curve was plotted using a Kaplan–Meier Survival Curve.
Heart function was analyzed with fluorescence microscopy (ZEISS Axio Observer for Life Science Research, Jena, Germany). Zebrafish larvae (4 dpf) were anesthetized in 0.03% tricaine and mounted on 3% methylcellulose. Videos were recorded (15 s, repeated three times, 488 nm excitation wavelength) and processed using Adobe Bridge CC 2020 and Adobe Premiere Pro V8.1.0.7 software. The width and length of the ventricules were measured at the end of diastole and systole to obtain cardiac dimensions, based on which the heart function parameters were obtained [27 (link)].
9
Cell Cycle Analysis via Flow Cytometry
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell cycle analysis was performed using the CyAn ADP flow cytometry (Beckman Coulter, High Wycombe, UK). SaOS2 and HOB cells were seeded in 100 mm2 plates to achieve 60–70% confluency following 24 h. At 2 days after transfection with morpholino antisense oligos (Gene Tools LLC) blocking SIRT1 RNA, the cells were harvested, centrifuged and washed with PBS. After fixation with ice-cold 70% EtOH, they were incubated in 7-AAD or anti-BrdU-FITC (BD Pharmingen, Oxford, UK). Data were analysed by Summit v4.3 (DakoCytomation, Glostrup, Denmark).
10
Zebrafish Gene Knockdown and Knockout
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!