Hs taq dna polymerase

Magnetic nanoparticles coated with glucuronic acid from Chemicell GmbH (Germany) specified as “50-nm fluidMAG-ARA”; hematoxylin and eosin from Biovitrum (Russia); potassium hexacyanoferrate (II) trihydrate, hydrochloric acid, and formaldehyde from Sigma-Aldrich (USA); K3-EDTA test tubes from Guangzhou Improve Medical Instruments (China); ExtractRNA, CleanRNA Standard kit, MMLV kit, HS Taq DNA Polymerase, and SYBR Green I dye from Evrogen (Russia) were used in the experiments. All other chemicals were of analytical grade.

Total RNA was isolated from 2 × 10⁶ cells using an Aurum total RNA minikit (Bio-Rad, Hercules, CA, USA) and GeneJET RNA Purification Kit (Thermo Scientific, Waltham, MA, USA) according to the manufacturers’ protocols. DNA was removed using DNase-I (Thermo Scientific, Waltham, MA, USA) or 12 M LiCl. The amount of isolated RNA was assessed using a NanoDrop One spectrophotometer (Thermo Scientific, Waltham, MA, USA). Reverse transcription was performed using MMLV reverse transcriptase and primer oligo(dT)₁₅ (Bio-Rad iScript cDNA Synthesis Kit, Hercules, CA, USA and Evrogen, Moscow, Russia) according to the manufacturers’ protocols.
The PCR reaction mixture (50 μL) contained 200 μM of each dNTP, 2.5 units of HS-Taq DNA polymerase (Evrogen, Moscow, Russia), 300 nM of each oligonucleotide (Syntol, Moscow, Russia) and 2 μg of cDNA. Sequences of primers and fluorescently labeled probes are shown in Table 1.
The reaction was carried out on DT-322 (DNA-Technology, Moscow, Russia) and CFX96 C1000 (Bio-Rad, Hercules, CA, USA) detecting thermal cyclers for 45 cycles. The program included preheating (1 min at 95 °C), DNA denaturation (15 s at 95 °C), primer annealing and amplification (1 min at 60 °C). The mRNA levels of tested genes were normalized on that of GAPDH or actin β. The absence of genomic DNA was monitored using RNA samples without reverse transcription.

After RNA isolation with Trizol reagent, RNA was reprecipitated in 3.3 M LiCl, centrifuged, and dissolved in water, DNAse-treated (DNAse I, Thermo Fischer Scientific, Wilmington, DE, USA). 1 mkg of total RNA was used to synthesize cDNA in RT+ and RT– reactions for each genotype using random hexamers with Mint reverse transcriptase (Evrogen, Moscow, Russia). Real-time PCR was performed with SYTO13 intercalating agent and HS Taq DNA polymerase (Evrogen, Moscow, Russia). For calibration the piwi^2/Nt genotype was used. Thermal cycling consisted of 5 min at 95 °C, followed by 45 cycles of denaturation (94 °C, 20 sec), annealing (64 °C, 20 sec), extension (72 °C, 20 sec), and a final extension of 5 min at 72 °C. RT– reactions did not show significant PCR signals. One biological replica per genotype was analyzed, in three technical replicates of real-time PCR. Adh transcript was used as a loading control.
The following primers were used: for HeT-A retrotransposon Het-s2 (CGCAAAGACATCTGGAGGACTACC) and Het-as2 (TGCCGACCTGCTTGGTATTG) [51 (link)], for Adh AdhRI_s (GCCTGCGTACATAGCCGAGAT) and AdhRI_as (GCTCCGTTAGTTGTTGGTTTCC).