Pcdna3.1 nt gfp topo ta expression kits

As described previously^{50 (link)}, full-length human ATP5α was generated by PCR amplification using pcDNA3.1/NT-GFP-TOPO TA Expression Kits (Invitrogen, Thermo Fisher Scientific, Waltham, MA) with primers (5′-ATG CTG TCC GTG CGC G-3′ and 5′-TTA AGC TTC AAA TCC AGC CAA G-3′). The deletion-mutations were generated by PCR amplification based on template pcDNA3.1/NT-GFP-TOPO ATP5α plasmid using QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). The sequences of primers used to generate those mutants are shown in supplementary Table 1. Plasmids were purified using Qiagen plasmid purification kits (QIAGEN Inc., Germantown, MD).

As previously described [18 (link)], the full-length TFG was generated by PCR amplification using pcDNA3.1/NT-GFP-TOPO TA Expression Kits (Invitrogen, Thermo Fisher Scientific, Waltham, MA). The deletion-mutations were generated by PCR amplification based on template pcDNA3.1/NT-GFP-TOPO TFG plasmid using pfuUltra II (Agilent Technologies, Santa Clara, CA). The sequences of primers used to generate those mutants were as following: del1_primer: GGATCTAAGTGGGAAGCTAAGACCCCTTGAATCAAGTC; del2_primer: TTTGTTAATGGCCAGCCACAAACTTCTCAGCCTACT; del3_primer: ACAAACTTACACTGCCCAAACTGGACCTGGTTATCGATAA.

A full-length human MCM3 were generated by PCR amplification using pcDNA3.1/NT-GFP-TOPO TA Expression Kits (Invitrogen) with primes (5'- ATG GCG GGT ACC GTG GTG) and (5'- TCA GAT GAG GAA GAT GAT GCC C). Deletion mutants of MCM3s were generated by PCR amplification using template pcDNA3.1/NT-GFP-TOPO MCM3 plasmid, as above. The deletions-mutations were generated using QuikChange Site-Directed Mutagenesis Kit (Stratagene). The sequence of primers sets in Table 1. Plasmids were purified using Qiagen plasmid purification kits (QIAGEN Inc.). One of deletion mutation construction (Δ337-476aa) might be lethal, we were failed to get bacterial colonies.