Lipofectmine 3000 transfection reagent

For overexpression of PTPROt were subcloned into the lentiviral vector PCDH-CMV-puro. Recombinant lentiviruses were produced by co-transfecting 293T cells with the lentiviral expression plasmid and packaging plasmids by Lipofectmine 3000 transfection reagent (Thermo Scientific) according to the manufacturer's protocol. Lentivirus was purified by ultracentrifugation and filtered for use.

For overexpression of SOCS2 were subcloned into the lentiviral vector PCDH-CMV-puro. The shRNA sequence specifically targeting SOCS2 was subcloned into the lentiviral vector pLKO.1-puro. Sequences of shRNA-SOCS2 are as followed:

GCATCCGTTTCCACGACTTTCCTCGAGGAAAGTCGTGGAAACGGATGCTTTTTT, and;

GCAAAGCTGGCACCAGAATTTCTCGAGAAATTCTGGTGCCAGCTTTGCTTTTTT.

Knockdown efficiencies are shown in Figure 2B. We selected shRNA specific for SOCS2 with the highest efficiencies for further experiments. Recombinant lentiviruses were produced by co-transfecting 293T cells with the lentiviral expression plasmid and packaging plasmids by Lipofectmine 3000 transfection reagent (Thermo Scientific) according to the manufacturer's protocol. Lentivirus was purified by ultracentrifugation and filtered for use.

DMEM, McCoy’5A, RPMI 1640 were purchased from GIBCO company, and fetal bovine serum was purchased from PAN-Biotech; Restriction enzymes (PmeⅠ, SacⅡ), rTaq DNA polymerase, T4 DNA ligase purchase since NEB company; DNA Marker, PMD18-T and dNTPs were purchased from TaKaRa Company. Lipofectmine 3000 transfection reagent purchased from Invitrogen company; The plasmid extraction kit was purchased from OMEGA; DNA recovery kit and PCR product purification kit were purchased from Qiagen Company. DNA PCR primers were synthesized by Shanghai Sangon. Anti-human IgG4 Fc (HRP) antibodies, anti-mouse Bcl-2, VEGF-Trap and CD34 antibodies were purchased from Abcam. Anti-mouse β-actin, caspase-3, BAX, STAT3, AKT, p44/42MAPK(ERK1/2), phospho-STAT3 (named P-STAT3), phospho-AKT (named P-AKT) and phospho-p44/42MAPK(ERK1/2) (named P-ERK1/2) antibodies were purchased from cell signaling technology.