Log In Sign up
The largest database of trusted experimental protocols

Topreal qpcr premix

Manufactured by Enzynomics
Visit Supplier

TOPreal qPCR PreMIX is a ready-to-use solution for real-time quantitative PCR (qPCR) analysis. It contains all the necessary components, including DNA polymerase, buffer, and dNTPs, to perform qPCR reactions.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (4 mentions) Topscript cdna synthesis kit, by Enzynomics (2 mentions) Rneasy plant mini kit, by Qiagen (2 mentions) Cfx connect real time pcr detection system, by Bio-Rad (2 mentions) Cfx manager 3, by Bio-Rad (2 mentions) Primescript rt master mix, by Takara Bio (2 mentions) Ntaq hot dna polymerase, by Enzynomics (2 mentions) Omniscript, by Qiagen (2 mentions) Accupower cyclescript rt premix kit, by Bioneer (1 mentions) Cfx96 real time detection system, by Bio-Rad (1 mentions) Dnase 1, by New England Biolabs (1 mentions) Rna spin total rna extraction kit, by iNtRON Biotechnology (1 mentions) Rotor gene q series software, by Qiagen (1 mentions) Cfx maestro, by Bio-Rad (1 mentions) Maxima first strand cdna synthesis kit for rt qpcr, by Thermo Fisher Scientific (1 mentions) Rotor gene q instrument, by Qiagen (1 mentions) Cfx connect real time system, by Bio-Rad (1 mentions) Primescript first strand cdna synthesis kit, by Takara Bio (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Takara thermal cycler tp600, by Takara Bio (1 mentions)

Close spelling variants of this product

TOPreal™ qPCR 2X PreMIX (112 citations) TOPreal qPCR 2× PreMIX (40 citations) TOPreal™ qPCR 2X PreMIX (SYBR Green with high ROX) (31 citations) TOPreal™ qPCR 2X PreMIX (SYBR Green; (25 citations) TOPreal™ qPCR 2X PreMIX (SYBR Green with low ROX) (16 citations) TOPreal™ SYBR Green qPCR PreMIX (16 citations) SYBR TOPreal qPCR 2X PreMix (9 citations) TOPreal qPCR 2× Premix - SYBR Green with high ROX (7 citations) TOPreal™ qPCR 2× PreMIX SYBR green (7 citations) TOPrealTM qPCR 2X PreMIX Kit (5 citations)

12 protocols using topreal qpcr premix

1

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Quantitative polymerase chain reaction (qPCR) was performed to determine mRNA levels. Total RNA was isolated using TRIzol reagent (Invitrogen, Waltham, MA, USA) according to the manufacturer's instructions. Complementary DNA synthesis was performed with 1 µg of RNA using the AccuPower CycleScript RT premix kit (Bioneer, Daedeok-gu, Daejeon, Korea). Real-time PCR amplification was performed using TOPreal™ qPCR Premix (Enzynomics, Yuseong-gu, Daejeon, Korea) on a 96-well optical plate. It was detected with the CFX96 real-time detection system (Bio–Rad). Under the following conditions: 1 cycle at 95 °C for 15 min; 50 cycles of 95 °C for 15 s and 60 °C for 15 s and 72 °C for 30 s, followed by 1 cycle of 65 °C to 95 °C every 0.5 °C for 1 s. In this study, only primer pairs leading to the synthesis of single fragments of appropriate size were used. The primer sets used in this study are listed in Table 2. Relative gene expression levels were calculated using the 2 − ∆∆Ct method and normalized to Actb expression levels.

Primers for real-time PCR.

GenesSense primers (5′-3′)Antisense primers (5′-3′)
ActbTCCATCATGAAGTGTGACGTGCTCAGGAGGAGCAATGAT
CebpaGAACAGCTGAGCCGTGAACTTAGAGATCCAGCGACCCGAA
Scd1AGCTGGTGATGTTCCAGAGGAAAGTCTCGCCCCAGCAGTA
Han J.H., Lee H.W., Jung S.H., Cho C.W., Kim T.J., Kang J.S, & Myung C.S. (2022). The anti-obesity effect of mulberry leaf (Mori Folium) extracts was increased by bioconversion with Pectinex. Scientific Reports, 12, 20375.
+ Open protocol
+ Expand
2

RT-qPCR-based Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from the seedlings using the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). Reverse transcription was performed using the TOPscript cDNA Synthesis Kit (Enzynomics, Daejeon, South Korea). Reverse-transcription quantitative PCR (RT-qPCR) reactions were performed using a CFX Connect Real-Time PCR Detection System (Bio-Rad, Hercules, CA, United States) in 96-well plates. TOPreal qPCR PreMIX (Enzynomics) was used for qPCR. The primers used in the RT-qPCR reactions are listed in Supplementary Table 2. The reference gene UBQ10 (AT4G05320) was included for internal control. The comparative ΔΔCT method was used to evaluate the relative values of each amplified product in the reaction according to the manufacturer’s instructions. The threshold cycle (CT) was automatically determined for each reaction by the system. Melting curve analysis was performed to evaluate the specificities of each primer.
Shin S.Y., Park J.S., Park H.B., Moon K.B., Kim H.S., Jeon J.H., Cho H.S, & Lee H.J. (2021). FERONIA Confers Resistance to Photooxidative Stress in Arabidopsis. Frontiers in Plant Science, 12, 714938.
+ Open protocol
+ Expand
3

Reverse Transcription qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using an RNA-spin total RNA extraction kit (iNtRON Biotechnology), and contaminating genomic DNA was removed by treatment with DNase I (NEB). cDNA was synthesized by reverse transcription using a PrimeScript RT Master Mix (Takara), and RT-qPCR was performed using TOPreal qPCR PreMIX (Enzynomics). Primers for qPCR reactions are summarized in Supplementary Table S2. The data analysis was performed by calculating ΔCq normalized to β-actin expression by the Bio-Rad CFX Manager 3.1 based on the MIQE guidelines (22 (link)). The MIQE checklist is provided in Supplementary Table S4. For assays involving heat shock treatment, cells were incubated at 42°C for 1 h, allowed to recover at 37°C for 3 h, and then were subjected to RT-qPCR analysis. For assays involving both siRNA and heat shock treatments, cells were incubated at 42°C for 1 h, allowed to recover at 37°C for 18 h, and then were subjected to RT-qPCR analysis.
In S., Kim Y.I., Lee J.E, & Kim J. (2019). RNF20/40-mediated eEF1BδL monoubiquitylation stimulates transcription of heat shock-responsive genes. Nucleic Acids Research, 47(6), 2840-2855.
+ Open protocol
+ Expand
4

Quantitative RT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
cDNA was synthesized from 2 µg total RNA using Maxima First Strand cDNA synthesis kit for RT-qPCR (Thermo Fisher Scientific), according to the manufacturer’s instructions. The gene expression levels were analyzed by quantitative reverse-transcription PCR using SYBR Green (TOPreal qPCR premix, Enzynomics) and a Rotor-Gene Q instrument (Qiagen) or Bio-Rad CFX Connect Real-Time System (Bio-Rad). The expression levels of gene transcripts were normalized to GAPDH (human) or 18S rRNA (mouse), and the results were evaluated by the Rotor-Gene Q series software (Qiagen) or Bio-rad CFX Maestro (Bio-Rad).
Park S., Park J.H., Kang U.B., Choi S.K., Elfadl A., Ullah H.M., Chung M.J., Son J.Y., Yun H.H., Park J.M., Yim J.H., Jung S.J., Kim S.H., Choi Y.C., Kim D.S., Shin J.H., Park J.S., Hur K., Lee S.H., Lee E.J., Hwang D, & Jeong K.S. (2021). Nogo-A regulates myogenesis via interacting with Filamin-C. Cell Death Discovery, 7, 1.
+ Open protocol
+ Expand
5

Quantitative Real-Time RT-PCR for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
First-strand cDNA was synthesized from 2 μg of total RNA with Random hexamer using Omniscript® reverse transcription (Qiagen, Valencia, CA) according to the manufacturer’s instruction. Briefly, qRT-PCR assays were performed using TOPreal™ qPCR premix (Enzynomics, Korea) under the following two-step conditions: denaturation at 95°C for 15 seconds followed by annealing and extension at 60°C for 40 seconds, for a total of 40 cycles. The 18S transcript was used as an endogenous reference to assess the relative level of mRNA transcript. RT-PCR assays were performed on a ABI thermal cycler TP600 (TaKaRa, Japan) using nTaq-HOT DNA polymerase (Enzynomics, Daejeon, South Korea) under the following 3 step conditions: denaturation at 94°C for 30s, annealing at 55-60°C for 30s and extension at 72°C for 40s with total 35–37 cycles. All primer pairs are listed in Additional file 7: Table S4.
Hong S.E., Song H.K, & Kim D.H. (2014). Identification of tissue-enriched novel transcripts and novel exons in mice. BMC Genomics, 15(1), 592.
+ Open protocol
+ Expand
6

Quantifying Murine Cancer Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from mouse cancer tissues using RNeasy Mini Kit (QIAGEN) following the manufacturer's instructions. cDNA was prepared using the PrimeScript first strand cDNA synthesis kit (Takara). For measuring murine ICAM‐1 and CXCL13 expression at the RNA level, cDNA was analyzed via qPCR using TOPreal qPCR PreMIX (Enzynomics) and the following primers:

β‐actin: Sense 5′‐CGTGCGTGACATCAAAGAGAA‐3′

Antisense 5′‐TGGATGCCACAGGATTCCAT‐3′

ICAM‐1: Sense 5′‐CCGCAGGTCCAATTCACACT‐3′

Antisense 5′‐TGGATGCCACAGGATTCCAT‐3′

CXCL13: Sense 5′‐CATAGATCGGATTCAAGTTACGCC‐3′

Antisense 5′‐TCTTGGTCCAGATCACAACTTCA‐3′

Lee S., Kim Y., Jeon B., Kim G., Sohn J., Yoon Y., Kim S., Kim Y., Kim H., Cha H., Lee N., Yang H., Chung J., Jeong A., Kim Y.Y., Kim S.G., Seo Y., Park S., Jung H.A., Sun J., Ahn J.S., Ahn M., Park H, & Yoon K.W. (2023). Intracellular Adhesion Molecule‐1 Improves Responsiveness to Immune Checkpoint Inhibitor by Activating CD8+ T Cells. Advanced Science, 10(17), 2204378.
+ Open protocol
+ Expand
7

Quantifying Gene Expression Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from the seedlings after appropriate treatments using RNeasy Plant Mini Kit (QIAGEN) with an on-column DNase I treatment. Reverse-transcription reaction was performed to produce cDNA using TOPscript cDNA Synthesis Kit (Enzynomics). Reverse-transcription quantitative PCR (RT-qPCR) reactions were carried out in 96-well plates with a CFX Connect Real-Time PCR Detection System (Bio-Rad) using TOPreal qPCR PreMIX (Enzynomics). The primers used in RT-qPCR reactions were listed in Supplementary Table 1. A reference gene UBC21 (AT5G25760) was included as an internal control for normalization. The comparative ΔΔCT method was used to evaluate relative quantities of each amplified product in the samples. The threshold cycle (CT) was automatically determined for each reaction by the system set with default parameters.
Lee H.J., Park J.S., Shin S.Y., Kim S.G., Lee G., Kim H.S., Jeon J.H, & Cho H.S. (2020). Submergence deactivates wound-induced plant defence against herbivores. Communications Biology, 3, 651.
+ Open protocol
+ Expand
8

qRT-PCR Assay for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
First-strand cDNA was synthesized from 2 μg of total RNA with Random hexamer using Omniscript® reverse transcription (Qiagen, USA) according to the manufacturer’s instruction. qRT-PCR assays were followed as previously described (Hong et al., 2008 (link)). Briefly, qRT-PCR assays were performed using TOPreal™ qPCR premix (Enzynomics, Korea) under the following two-step conditions: denaturation at 95°C for 15 s followed by annealing and extension at 60°C for 40 s, for a total of 40 cycles. The 18S transcript was used as an endogenous reference to assess the relative level of mRNA transcript. The following primers were used:

ANP, 5′-TCGTCTTGGCCTTTTGGC-3′ (sense)

and 5′-TCCAGGTGGTCTAGCAGGTTCT-3′ (antisense)

BNP, 5′-AGGGAGAACACGGCATCATT-3′ (sense)

and 5′-GACAGCACCTTCAGGAGAT-3′ (antisense)

18S, 5′-TTCTGGCGAACGGTCTAGACAAC-3′ (sense)

and 5′-CCACTGGTCTTGGTGTGCTGA-3′ (antisense)

Kim T., Kim J.O., Oh J.G., Hong S.E, & Kim D.H. (2014). Pressure-Overload Cardiac Hypertrophy Is Associated with Distinct Alternative Splicing Due to Altered Expression of Splicing Factors. Molecules and Cells, 37(1), 81-87.
+ Open protocol
+ Expand
9

Quantitative RT-PCR Analysis of Rat Cardiomyocytes

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
After extraction of total RNA from rat neonatal cardiomyocytes using TRIzol reagent (Invitrogen), 400 ng of RNA was reversetranscribed into cDNA using the Prime Script RT reagent kit (TaKaRa) according to the manufacturer’s instruction. qRT-PCR assays were followed as previously described [15 (link)]. Briefly, qRT-PCR assays were performed using TOPreal qPCR PreMix (Enzynomics) under the following two-step conditions: denaturation at 95°C for 5 seconds; and annealing and extension at 60°C for 40 seconds, for a total of 40 cycles. The 18S transcript was used as an endogenous reference to assess the relative level of mRNA transcript. RT-PCR assays were performed on a TAKARA thermal cycler TP600 (TaKaRa) using nTaq-HOT DNA polymerase (Enzynomics) under the following 3 step conditions: denaturation at 94°C for 30s, annealing at 55–60°C for 30s and extension at 72°C for 40s with total 30–35 cycles. The sequences of specific primers for 18S and each of the transcripts are shown in Table A in S1 File.
Song H.K., Kim J., Lee J.S., Nho K.J., Jeong H.C., Kim J., Ahn Y., Park W.J, & Kim D.H. (2015). Pik3ip1 Modulates Cardiac Hypertrophy by Inhibiting PI3K Pathway. PLoS ONE, 10(3), e0122251.
+ Open protocol
+ Expand
10

RNA Extraction and Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
TRIzol™ reagent (Invitrogen) was used to extract RNA from cells. Reverse Transcription Kit (Promega) was used to synthesize complementary DNA (C‐DNA) from 1 µg of RNA. Quantitative real‐time PCR was carried out using the TOPreal™ qPCR preMIX (Enzynomics).
Kang H.R., Moon J.Y., Ediriweera M.K., Song Y.W., Cho M., Kasiviswanathan D, & Cho S.K. (2020). Dietary flavonoid myricetin inhibits invasion and migration of radioresistant lung cancer cells (A549‐IR) by suppressing MMP‐2 and MMP‐9 expressions through inhibition of the FAK‐ERK signaling pathway. Food Science & Nutrition, 8(4), 2059-2067.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!