The RNA was isolated from ARPE-19 cells using the TRIzol reagent (Thermo Fisher Scientific, Inc.). In order to perform qPCR, a three-step amplifying protocol using SYBR Green Real-time PCR Master Mixes (cDNA Synthesis kit; Thermo Fisher Scientific, Inc.), as well as 1,000 ng template cDNA, 12.5 µl SYBR Green Real-time PCR Master Mixes, and 0.5 µl forward primers and 0.5 µl reverse primers, which were diluted in a 25 µl reaction volume. A StepOnePlus Real-Time PCR system was employed (Applied Biosystems; Thermo Fisher Scientific, Inc.). UCP2 and GAPDH primers were used in this experiment (Table I ). The thermocycling conditions were as follows: 95°C for 10 min; followed by 40 cycles of 95°C for 15 sec, 60°C for 30 sec, 72°C for 32 sec; followed by 95°C for 15 sec, 60°C for 60 sec and 95°C for 15 sec. Each sample was run and analyzed in triplicate. Expression levels were quantified using the 2−ΔΔCq method (29 (link),32 (link)).
Sybr green real time pcr master mixes
Manufactured by Thermo Fisher Scientific
Sourced in United States, Italy
SYBR Green Real-Time PCR Master Mixes are pre-formulated solutions for quantitative real-time PCR (qPCR) assays. They contain SYBR Green I dye, DNA polymerase, buffer, and other essential components required for real-time PCR amplification and detection.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (81 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (20 mentions)
Rneasy mini kit, by Qiagen (19 mentions)
Trizol, by Thermo Fisher Scientific (16 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (10 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (10 mentions)
Superscript 3 first strand system kit, by Thermo Fisher Scientific (8 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (7 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (6 mentions)
Nanodrop 2000c, by Thermo Fisher Scientific (6 mentions)
Maxima h minus first strand cdna synthesis kit, by Thermo Fisher Scientific (6 mentions)
Iscript cdna synthesis kit, by Bio-Rad (5 mentions)
Superscript 3 reverse transcriptase kit, by Thermo Fisher Scientific (5 mentions)
Omniscript, by Qiagen (4 mentions)
Superscript 3, by Thermo Fisher Scientific (4 mentions)
Abi prism 7900ht sequence detection system, by Thermo Fisher Scientific (4 mentions)
Superscript 4 reverse transcriptase, by Thermo Fisher Scientific (4 mentions)
Primescript rt reagent kit, by Takara Bio (4 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (4 mentions)
Nanodrop, by Thermo Fisher Scientific (4 mentions)
159 protocols using sybr green real time pcr master mixes
1
Quantitative PCR Analysis of UCP2 in ARPE-19 Cells
2
Evaluating Gene Expression under LPS and Guanabenz
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
J774.1 cells at 1 × 105 were seeded into 6-well plates and allowed to adhere overnight. Cells were stimulated with lipopolysaccharide (10 ng/ml) for 6 h in the presences or absence of guanabenz (50 μM) as previously reported (23 (link)). Total RNA was isolated from the cells using TRIzol LS (Invitrogen), and cDNA was generated using Omniscript (Qiagen). RT-qPCR was carried out using SYBR Green real-time PCR master mixes (Invitrogen) and the StepOnePlus Real system (Applied Biosystems). Relative levels of transcripts were calculated with the ΔΔCT method using GAPDH as the internal control. The relative levels of the target mRNAs from the untreated cells were adjusted to 1 and served as the basal control value. Each experiment was performed three times, each with three technical replicates. The primers used are listed in Table S1 in the supplemental material.
3
Validation of Differentially Expressed Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-qPCR was used to confirm the lncRNA and circRNA expression profiles obtained from the microarray data. All the samples were normalized to the signal generated by GAPDH (Sangon Biotech, Co., Ltd.) (25 (link)). Data are shown as the fold-change (2−ΔΔCq) (29 (link)). Student's t-tests were used and P<0.05 was considered to indicate a statistically significant difference. The cDNA was used as the template in an SYBR-Green Real-Time PCR Master Mixes (Invitrogen; Thermo Fisher Scientific, Inc.) and in triplicate subjected to denaturation at 94°C for 4 min and 35 cycles of 94°C for 30 sec, and 60°C for 30 sec, followed by extension at 72°C for 10 min using the specific primers. The primer sequences were as follows: Circ-0025580: F, 5′-CACGAGGGGCTTGTAGGATA-3′; R, 5′-AGGAAACCAAGCCACCAAG-3′. Circ-0024108: F, 5′-AGGCAAGGGATAACTCTTCTAACAC-3′; R, 5′-TTGGCAAATCTGGCGTGTAA-3′. Circ-0025933: F, 5′-GGAATGGAACGACATGCAAA-3′; R, 5′-GACACACATTGTATTTTCACGACAGT-3′. lnc-KLHDC7A-6:2: F, 5′-GGGCGTGAGGTGTGTGTTTA-3′; R, 5′-CGCTTACAAGCAGCAGGTAG-3′. LOC440173: F, 5′-GAGGTACCAAGAGAAGTGCTGATG-3′; R, 5′-GTTAATGCTTTCGGCCAAGATC-3′. EPB41L4A-AS1: F, 5′-GTCATCTATGGAGAGGAAAGGTACAAA-3′; R, 5′-TGTCACCCCAAACCTCAAATG-3′. SMAD5-AS1_3: F, 5′-GTTCTGGTGGTGATGGCATTG-3′; R, 5′-CATCTGGCTCAGGGTGTTCA-3′. GAPDH: F, 5′-TGACTTCAACAGCGACACCCA-3′; R, 5′-CACCCTGTTGCTGTAGCCAAA-3′.
4
Quantifying TXNIP Gene Expression in Organoids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from organoid samples using an RNeasy RNA isolation kit (Qiagen), then cDNA was synthesized using AccuPower RT-PCR PreMix (Bioneer). qRT-PCR was performed using SYBR Green Real-time PCR Master Mixes (Invitrogen). qRT-PCR analysis was conducted in a Rotor-Gene Q real-time PCR cycler (Qiagen) after 1/50 dilution of the reverse transcription reaction. Gene expression of all target genes was normalized against the expression level of glyceraldehyde-3-phosphate dehydrogenase in each sample. Human TXNIP primers were used as follows: primer-1 forward 5′-AGT GTA ACA GCA AGC CTA ATG-3′, reverse 5′-GTC AAG AAA AGC CTT CAC CC-3′; primer-2 forward 5′-CGA ATT GTG GTC CCC AAA C-3′, reverse 5′-TTG CAG CCC AGG ATA GAA G-3′; primer-3 forward 5′-AGA AGT TGT CAT CAG TCA GAG G-3′, reverse 5′-ATT ACC AGG GGC AGG TCA AG-3′; primer-4 forward 5′-AAG CAG CAG AAC ATC CAG C-3′, reverse 5′-AGG GGC ATA CAT AAA GAT AGG G-3.
5
Quantification of Host Transcripts upon Parasite Infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
2x105 MEF cells were plated in 6-well plates and allowed to adhere overnight. Cells were infected with tachyzoites for 2 h, washed in PBS, then cultured in DMEM for the indicated times. RNA was isolated from the infected cells using TRIzol LS Reagent (Invitrogen) and cDNA was generated using Omniscript (Qiagen). RT-qPCR was carried out using primers specific to the indicated gene transcript (Table 1 ), in combination with SYBR Green Real-Time PCR Master Mixes (Invitrogen) and StepOnePlus Real System. Relative levels of transcripts were calculated with the ΔΔCt method using genes encoding GAPDH and β-actin as internal controls. The relative levels of the target mRNAs from the mock-infected samples were adjusted to 1 and served as the basal control value. Each experiment was performed three times, each with three technical replicates.
6
mRNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was isolated utilizing the Trizol reagent (Invitrogen) and used for reverse transcription (Thermo Fisher Scientific). Then qRT-PCR was performed using the ABI7500 (Applied Biosystems) by mixing cDNA, primers and SYBR®Green Real-Time PCR Master Mixes (Invitrogen). The primer sequences are included in Supplementary Material 37 (link).
7
Gene Expression Analysis in Cells and Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cultured cells and heart tissues were washed with cold PBS and then subjected to RNA extraction with TRIZOL reagent (ThermoFisher). Next, the SuperScript III first-strand synthesis system kit (Invitrogen) was applied for cDNA synthesis with 1 ug of total RNA. Finally, SYBR green real-time PCR master mixes (Invitrogen) were applied to analyze the expression of target genes with the cDNA. The primers are shown in Table 1 . The double delta CT method was applied for the quantification of mRNA expression.
8
Quantifying gene expression in hMBOs and hFPCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from hMBOs and hFPCs using a Trizol reagent. cDNA was synthesized using AccuPower RT-PCR PreMix (Bioneer). Real-time PCR was performed using SYBR Green Real-Time PCR Master Mixes (Invitrogen) under 40 cycles with the following conditions: denaturation at 95°C for 1 min, annealing at 58°C for 30 s, and extension at 72°C for 30 s. The primer sequences are shown in Supplementary Table S5 . The expression level of the housekeeping gene GAPDH was normalized using the comparative Ct method: 2−ΔΔCt.
9
Quantitative Analysis of Sialyltransferase Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was prepared from mouse epididymis at the time of explantation by RNAeasy micro kit (Qiagen, Hilden, Germany). Subsequently, first strand cDNA was generated by iScript cDNA Synthesis Kit (Bio Rad Laboratories). Intron spanning primers were used to amplify ST8Sia II, ST8Sia IV and β-Actin targets using SYBR Green Real-Time PCR Master Mixes (Invitrogen life technologies) according to manufacturers’ introductions. Primers used in quantitative PCR expression analysis:
ST8SiaII for: AGACACAACCAGACGCTCTCTCT,
ST8SiaII rev: GAATAATGTCTCCAGGCTTCAGG;
ST8SiaIV for: CAAAAGAAATAGCCAGAACTGAGG,
ST8SiaIV rev: CCTTCCGGATGATTTTATCAGAG;
β-Actin for: CCATCATGAAGTGTGACGTTGA,
β-Actin rev: CATCGTACTCCTGCTTGCTGAT.
cDNA samples were denatured at 95°C for 3:30 min, followed by 35 cycles of each 20 s at 95°C, 20 s at 60°C and 20 s at 72°C. For melting curve analysis PCR samples were slowly heated from 72°C to 95°C and stored at 20°C. Amplified products were separated by gel electrophoresis using 2% agarose gel for quality control. In addition, amplification efficiency was determined by analyzing the slope of a CT/log (template concentration) plot and primer efficiencies of 100% +/- 5% were accepted for normalization. Emitted fluorescence was detected online using SYBR green real-time PCR system (Bio Rad, iCycler iQ Real-Time PCR Detection System).
ST8SiaII for: AGACACAACCAGACGCTCTCTCT,
ST8SiaII rev: GAATAATGTCTCCAGGCTTCAGG;
ST8SiaIV for: CAAAAGAAATAGCCAGAACTGAGG,
ST8SiaIV rev: CCTTCCGGATGATTTTATCAGAG;
β-Actin for: CCATCATGAAGTGTGACGTTGA,
β-Actin rev: CATCGTACTCCTGCTTGCTGAT.
cDNA samples were denatured at 95°C for 3:30 min, followed by 35 cycles of each 20 s at 95°C, 20 s at 60°C and 20 s at 72°C. For melting curve analysis PCR samples were slowly heated from 72°C to 95°C and stored at 20°C. Amplified products were separated by gel electrophoresis using 2% agarose gel for quality control. In addition, amplification efficiency was determined by analyzing the slope of a CT/log (template concentration) plot and primer efficiencies of 100% +/- 5% were accepted for normalization. Emitted fluorescence was detected online using SYBR green real-time PCR system (Bio Rad, iCycler iQ Real-Time PCR Detection System).
10
Quantitative Real-Time PCR Analysis of mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNAs were isolated from the human cerebral organoids or cells using Trizol reagent, then cDNA was synthesized using AccuPower RT-PCR PreMix (Bioneer). The qRT-PCR was performed using SYBR Green Real-time PCR Master Mixes (Invitrogen) under the following reaction conditions (35 cycles): denaturation at 95°C for 1 min, annealing at 58°C for 30 s, and extension at 72°C for 30 s. Primer sequences were described in Table 2 . The expression levels were normalized relative to the expression of the housekeeping gene GAPDH[27 (link)] using the comparative Ct–method 2−ΔΔCt.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!