The largest database of trusted experimental protocols

254 protocols using gapdh

1

Quantifying Protein Expression via Western Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols
Western blotting assay was performed as previously described. Antibody against PAICS (catalog number: A6450), ERCC1 (catalog number: A18066), XPA (catalog number: A1626) and GAPDH was purchased from ABClonal Inc. The protein expression level of PAICS, ERCC1 and XPA was normalized to GAPDH expression and quantified using Image J software.13 (link)
+ Open protocol
+ Expand
2

Silencing hsa-circ-0044226 in TGF-β1-activated HFL1 fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols
HFL1 human fibroblast cells were purchased from PROCELL and cultured in Ham's F12K medium supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 μg/ml streptomycin. The cells were maintained at 37 °C in a humidified atmosphere containing 5% CO2. To silence hsa-circ-0044226, 40,000 HFL1 cells were seeded in each well of a 6-well plate and cultured in Ham's F12K medium supplemented with 10% FBS. The cells were then activated with 10 ng/ml TGF-β1 (Novoprotein) for 24 h. Subsequently, HFL1 cells were transfected with hsa-circ-0044226-specific siRNA (5’TGAGGTGTTGTACATGCATTATAA3’) or scramble RNA using Lipofectamine™ 3000 Transfection Reagent (Thermo Fisher Scientific, Cat#L3000-015) following the manufacturer's instructions. After 24 h, the cells were collected for RT-qPCR and Western blot analyses, according to the manufacturer's instructions. The primary antibodies used for Western blotting included α-SMA (Boster Biological Technology, Cat#BM0002), fibronectin (Cell Signaling Technology, Cat#26836S), collagen I (Cell Signaling Technology, Cat#84336), and GAPDH (Abclonal, Cat#A19056). The secondary antibodies used were goat anti-mouse IgG-HRP (Abclonal, Cat#AS003) and goat anti-rabbit IgG-HRP (abcam, Cat#ab6721).
+ Open protocol
+ Expand
3

Western Blot Analysis of VGF Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols
In brief, the proteins of tissues were extracted with the radio-immunoprecipitation assay (RIPA) lysis buffer (Beyotime, China) containing 1mM Phenylmethylsulfonyl fluoride (PMSF, Beyotime, China). The concentration of protein was detected using the BCA assay kit (MCE, China). 50ug of protein was subjected to 10% SDS-PAGE and transferred to PVDF membranes (Millipore, USA). Then, the membranes were blocked in 5% nonfat dried skimmed milk for 1.5h at room temperature. After that, the PVDF membranes were incubated with primary antibodies containing VGF (1:1000, Abcam, England, ab74140) and GAPDH (1:50000, Abclonal, China, AC002) overnight at 4 °C. Finally, the membranes were incubated with corresponding secondary antibodies (1:3000, Proteintech, China, SA00001-1 and SA00001-2) for 1.5h at room temperature and visualized with the ChemiDoc-XRS+ system (Bio-Rad, USA).
+ Open protocol
+ Expand
4

Senescence-Associated β-Galactosidase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Collagenase type Ⅱ, fetal bovine serum (FBS), 0.25% trypsin enzyme and penicillin/streptomycin were purchased from Gibco (Carlsbad, CA, United States). Dulbecco’s modified Eagle’s medium/F12 (DMEM/F12) and phosphate buffer saline (PBS) were obtained from HyClone Co. (Logan, United States). Primary antibodies against GLB1, LTF, P65 and GAPDH were purchased from Abclonal (Wuhan, China). The TRIzol reagent was purchased from Invitrogen Co. (Carlsbad, United States). The SYBR Green dye and reverse transcription kits were purchased from Servicebio Co., Ltd. (Wuhan, China). The SA-β-gal staining kits were obtained from Beyotime Co., Ltd (Shanghai, China). All primers were Tianyi Biotech Co., Ltd (Wuhan, China). The information of primary antibody is as follows: 3-phosphate dehydrogenase de glycéraldéhyde (GAPDH) (AC033) was purchased from Abclonal Biotech Co., Ltd. (Wuhan, China). The antibody for LTF (A12902) was purchased from Abclonal Biotech Co., Ltd. (Wuhan, China). The antibody for P65 (A2547) was purchased from Abclonal Biotech Co., Ltd. (Wuhan, China). The antibody for GLB1 (abs136187) was purchased from Absin Bioscience Inc (Shanghai, China).
+ Open protocol
+ Expand
5

Western Blot Analysis of EMT Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Proteins were extracted using RIPA buffer (CWBIO, China). After being electrophoresed by SDS-PAGE, the samples were transferred to nitrocellulose membranes and incubated with primary antibodies specific for E-cadherin (diluted 1:1000, Proteintech, USA), vimentin (diluted 1:1000, ABclonal, China), N-cadherin (diluted 1:1000, ABclonal, China), HMGA2 (diluted 1:1000, ABclonal, China) and GAPDH (diluted 1:1000, ABclonal, China) at 4 °C overnight. Then the membranes were incubated with secondary antibodies at room temperature for 1 h. Signals were detected with images acquisition using Immobilon ECL substrate (Millipore, Germany) and Optimax X-ray Film Processor (Protec, Germany).
+ Open protocol
+ Expand
6

Torularhodin Isolation and Purification from Sporidiobolus pararoseus

Check if the same lab product or an alternative is used in the 5 most similar protocols
Torularhodin (purity > 95%) was isolated and purified from the extract of Sporidiobolus pararoseus (JD-2 CCTCC M 2010326) according to a previously published method [10 (link)]. Animal diets were purchased from TROPHIC Animal Feed High-tech Co., Ltd. Commercial kits for serum concentration of total cholesterol (TC), low-density lipoprotein cholesterol (LDL-c), high-density lipoprotein cholesterol (HDL-Cc), and triglyceride (TG) were purchased from Jiancheng Technology Co. (Nanjing, China). Hematoxylin and eosin (H&E) were obtained from Servicebio Technology Co. (Wuhan, China). Antibodies of PPARα, PPAR-γ, CYP7A1, CPT1A, SLC27A4, and GAPDH were obtained from ABclonal Technology Co. Ltd. (Wuhan, China). Western fluorescence detection reagent was obtained from Beyotime Biotechnology (Shanghai, China).
+ Open protocol
+ Expand
7

BMSC Protein Extraction and Western Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols
According to a previously established method [31 (link)], RIPA (Beyotime, Shanghai, China) and PMSF (Beyotime, Shanghai, China) were prepared in working solution that was used to extract the total protein of BMSCs. Proteins were electrophoresed and resolved by SDS-PAGE gels, and PVDF membranes (Millipore, Billerica, MA, USA) were used to transfer the proteins on the gels. Primary antibodies against RUNX2 (Wanleibio, Shenyang, China), OPN (Wanleibio, Shenyang, China), AKT1 (Abcam, Cambridge, UK), P-AKT1 (Abcam, Cambridge, UK), and GAPDH (ABclonal, Wuhan, China) were diluted 1:1000 and incubated with PVDF membranes overnight at 4°C. After washing thrice with TBST, the PVDF membranes were incubated with the corresponding secondary antibodies (ABclonal, Wuhan, China) at a dilution ratio of 1:5000 for 1 h. Finally, proteins were visualized by chemiluminescence, and quantitatively analyzed using ImageJ software.
+ Open protocol
+ Expand
8

Western Blot Analysis of m6A Regulators in HCC

Check if the same lab product or an alternative is used in the 5 most similar protocols
HCC specimens were collected during surgery. The proteins separated on gels after electrophoresis are transferred to PVDF membranes and subsequently incubated with primary and secondary antibodies. The following primary antibodies were incubated for 12 h at 4 °C: GAPDH (1:10,000, ABclonal), YTHDF1 (1:1000, ABclonal), YTHDF2 (1:1000, ABclonal) and YTHDF3 (1:1000, ABclonal), KIAA1429(1:1000, Proteintech), METTL3(1:1000, Proteintech), RBM15(1:1000, Proteintech), ZC3H13(1:1000, Proteintech), METTL16(1:1000, Proteintech), ALKBH5(1:1000, Proteintech), METTL14(1:1000, Proteintech), WTAP(1:1000, Proteintech), HNRNPC(1:1000, Proteintech), YTHDC1(1:1000, Proteintech), YTHDC2(1:1000, Proteintech), FTO(1:1000, Proteintech). The secondary antibody (1:5000, ABclonal) was incubated for 2 h at room temperature. Immunoreactive bands were developed using an enhanced chemiluminescence detection kit (Genview Scientific Inc., USA). All experiments were performed in triplicate.
+ Open protocol
+ Expand
9

Western Blot Analysis of Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cultured cells were collected and lysed with enhanced radioimmunoprecipitation assay lysis buffer (Boster Biological Technology, Wuhan, P.R. China) containing protease inhibitors. The bicinchoninic acid kit (Boster Biological Technology) was utilized to determine the protein concentration. Proteins were separated with 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, the separated proteins were electro-transferred to polyvinylidene fluoride membrane (Immobilon P, Millipore, Billerica, MA, USA), and the membrane was treated with 5% skimmed milk at ambient temperature for 2 h to block non-specific binding. The membrane was incubated with primary antibody at 4°C overnight and then with horseradish peroxidase conjugated secondary antibody at 37°C for 1 h. Enhanced chemiluminescence reagent (Thermo Fisher Scientific) was utilized to visualize the immunoreactive bands, followed by imaging using ChemiDoc XRS Plus luminescent image analyzer (Bio-Rad, Hercules, CA, USA). ImageJ analysis software was utilized to quantify the gray value of protein bands. Antibodies included SIRT6 (A7416, 1:2,000, ABclonal, Woburn, MA, USA), NRP-1 (A19087, 1:2,000, ABclonal), GAPDH (AC033, 1:50,000, ABclonal), Lin28B (ab191881, 1:2,000, abcam), rabbit secondary antibody (AS014, 1:10,000, ABclonal), and murine secondary antibody (AS003, 1:10,000, ABclonal).
+ Open protocol
+ Expand
10

Neutrophil Protein Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Neutrophils were collected and added to the RIPA lysis solution and the protease inhibitor PMSF. After 30 min incubation on ice, supernatants were extracted with a 10,000 rpm centrifugation. Denatured PMNs protein extract was subjected to SDS-PAGE and transferred to nitrocellulose membranes, which were then blocked for 1 h at room temperature with 5% skim milk. After incubated with primary antibodies against C5/C5a, p-p38 MAPK/t-p38 MAPK, NF-κB p65 (Abcam, Cambridge, USA), and GAPDH (A19056, ABclonal) overnight at 4 °C, the horseradish peroxidase-conjugated goat anti-mouse or rabbit monoclonal antibody was used to detect the bound primary antibodies. The membranes were exposed with a chemiluminescence imaging system, and the results were performed with the Image J software system (NIH, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!