Reverse transcription kit

Manufactured by Bio-Rad

Sourced in United States

The Reverse Transcription Kit is a laboratory tool designed to convert RNA into complementary DNA (cDNA) molecules. The kit provides the necessary reagents and enzymes to perform this reverse transcription process, which is a critical step in various molecular biology applications, such as gene expression analysis and cDNA library construction.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (25 mentions) Trizol, by Thermo Fisher Scientific (12 mentions) Sybr green supermix, by Bio-Rad (10 mentions) Sybr green, by Bio-Rad (8 mentions) Rneasy mini kit, by Qiagen (8 mentions) Cfx rt pcr detection system, by Bio-Rad (5 mentions) Trizol reagent, by Merck Group (4 mentions) Cfx connect real time system, by Bio-Rad (4 mentions) Sybr green pcr master mix, by Bio-Rad (4 mentions) Nanodrop 2000, by Thermo Fisher Scientific (4 mentions) Rneasy kit, by Qiagen (3 mentions) Cfx96 real time pcr detection system, by Bio-Rad (3 mentions) Trizol, by Merck Group (3 mentions) Cfx96 thermocycler system, by Bio-Rad (2 mentions) Lightcycler 480 rt pcr detection system, by Roche (2 mentions) Mouse il 17a mm il17a sg, by Qiagen (2 mentions) Sybr premix ex taq, by Takara Bio (2 mentions) Pcr thermocycler, by Eppendorf (2 mentions) Cfx96 real time system, by Bio-Rad (2 mentions) Sybr green rt pcr kit, by Bio-Rad (2 mentions)

76 protocols using reverse transcription kit

Validating Differential Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Following RNA-seq analysis, differentially expressed genes were validated using quantitative RT-PCR.
The reverse transcription reaction for first-strand cDNA synthesis was performed using the Reverse Transcription Kit (Bio-Rad). Primers used for all genes are listed in Table S1. Primers used for internal control gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were forward (CATGAGAAGTATGACAACAGCCT) and reverse (AGTCCTTCCACGATACCAAAGT).
The PCR reaction was performed at 95°C for 3 min, followed by 40 cycles of 95°C for 30 s and 60°C for 40 s. Quantitative RT-PCR analysis was performed with the CFX Connect Real-Time system (Bio-Rad). The gene expression levels for each individual sample were normalized to GAPDH. The relative expression was analyzed using the 2^−ΔΔCt method. Experiments were repeated four times (N=4)

Marinello W.P., Mohseni Z.S., Cunningham S.J., Crute C., Huang R., T.i.m., R.e.d.d.y., Zhang J.J, & Feng L. (2020). Perfluorobutane sulfonate exposure disrupted human placental cytotrophoblast cell proliferation and invasion involving in dysregulating preeclampsia related genes. FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(11), 14182-14199.

+ Open protocol

+ Expand

RNA Extraction and RT-qPCR Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from fresh or frozen tissues by homogenization in TRIzol reagent (Invitrogen) as previously described (Zhu et al., 2016 (link)). We used 1 μg RNA to transcribe cDNA with a reverse transcription kit (Bio-Rad). Most of RT-qPCR primers were from the Harvard Primer Bank (https://pga.mgh.harvard.edu/primerbank/). The relative expression levels were calculated using the comparative threshold cycle method, normalized to the housekeeping gene Gapdh.

Li N., Zhao S., Zhang Z., Zhu Y., Gliniak C.M., Vishvanath L., An Y.A., Wang M.Y., Deng Y., Zhu Q., Shan B., Sherwood A., Onodera T., Oz O.K., Gordillo R., Gupta R.K., Liu M., Horvath T.L., Dixit V.D, & Scherer P.E. (2021). Adiponectin preserves metabolic fitness during aging. eLife, 10, e65108.

+ Open protocol

+ Expand

RT-PCR Validation of RNA-Seq in Mouse Models

Check if the same lab product or an alternative is used in the 5 most similar protocols

Expression of selected genes defined by RNA-Seq in both C57BL/6 and Fxr^−/− mice was validated by RT-PCR. Three wild type replicates and three FXR^−/− replicates were used for each age in RT-PCR analysis. Total RNA was converted into cDNA using Reverse Transcription kit according to the manufacturer’s protocol (Bio-Rad). PCR was performed using a CFX-96 thermocycler system (Bio-Rad, Hercules, CA, USA). To create the reaction mixture, 100 ng cDNA was added to 2X SYBR Green PCR Master Mix (Bio-Rad), with 10 μM forward primers and 10 μM reverse primers. Primer sequences for selected genes are listed in Supplemental Table S1 available online at http://www.agialpress.com/journals/nurr/2017/101308. PCR was conducted at 95°C for 3 minutes, followed by 40 cycles of 95°C for 10 seconds and 60°C for 1 minute. Results of RT-PCR for selected genes are shown in Supplemental Figure S1 available online at http://www.agialpress.com/journals/nurr/2017/101308, alongside FPKM results. The supplemental Table S2 available online at http://www.agialpress.com/journals/nurr/2017/101308 shows a strong correlation for the ten selected genes with Pearson’s correlation r values between 0.857 and 0.967 for C57BL/6 mice and between 0.960 and 0.999 for Fxr^−/− mice between the two quantification methods.

Peng L., Piekos S.C., Guo G.L, & Zhong X.B. (2017). Role of Farnesoid X Receptor in the Determination of Liver Transcriptome during Postnatal Maturation in Mice. Nuclear receptor research, 4, 101308.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from kidney tissues and bone marrow cells using TRIzol reagent (Invitrogen, Carlsbad, CA). Aliquots (1 μg) of total RNA were reverse transcribed using cDNA Reverse Transcription kit (Bio-Rad, Hercules, CA). Quantitative real-time PCR was performed using IQ SYBR green supermix reagent (Bio-Rad, Hercules, CA) with a Bio-Rad real-time PCR machine according to the manufacturer’s instructions. Relative mRNA expression levels of target genes were obtained by normalizing to GAPDH in each sample using the comparative Ct method (ΔΔCt) and the relative quantification was calculated as 2−ΔΔCt (25 (link)). The gene-specific primer sequences were: arginase (Arg1) forward, 5’-CTCCAAGCCAAAGTCCTTAGAG-3’,-reverse, 5’-AGGAGCTGTCATTAGGGACATC-3’;mannose receptor C-type 1 (MRC1)-forward, 5’-GGTCTATGGAACCACGGATGA-3’,-reverse, 5’-TGCCCAGTAAGGAGTACATGG-3’;found in inflammatory zone 1 (Fizz1)-forward, 5’-CCAATCCAGCTAACTATCCCTCC-3’,-reverse, 5’-ACCCAGTAGCAGTCATCCCA-3’;CCL17-forward, 5’- CGAGAGTGCTGCCTGGATTACT-3’,-reverse, 5’- GGTCTGCACAGATGAGCTTGCC-3’;GAPDH-forward, 5’-CCAATGTGTCCGTC?A3B2 ek?>GCGTGGATCT-3’,-reverse, 5’-GTTGAAGTCGCAGGAGACAACC-3’.

Jiao B., An C., Tran M., Du H., Wang P., Zhou D, & Wang Y. (2021). Pharmacological Inhibition of STAT6 Ameliorates Myeloid Fibroblast Activation and Alternative Macrophage Polarization in Renal Fibrosis. Frontiers in Immunology, 12, 735014.

+ Open protocol

+ Expand

SLCO4A1-AS1 Expression Profiling in Cancers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were extracted using TRIzol reagent (Invitrogen, USA). One µg of total RNA from the samples was reverse transcribed using a Reverse Transcription Kit (BioRad, Hercules, CA, USA). RT-PCR was performed using SYBR Green (BioRad) in the LightCycler 480 RT-PCR Detection System (Roche). Primers were synthesized by Sangon Biotech Company (Shanghai, China): SLCO4A1-AS1 forward 5'-CACTTTCCAGCCTCTCACCA-3', and reverse 5'-GGCCACCTCCTCAAACAAGA-3'; β-actin forward 5'-TCACCAACTGGGACGACATG-3', and reverse 5'-GTCACCGGAGTCCATCACGAT-3'. SLCO 4A1-AS1 expression was normalized to the respective β-actin expression level. Relative expression was calculated using the equation: ΔCt = Ct (target gene) - Ct (β-actin), fold expression = 2^{-(ΔCt(tumor) -} ΔCt(normal)) by Cq value.

Tang R., Chen J., Tang M., Liao Z., Zhou L., Jiang J., Hu Y., Liao Q., Xiong W., Tang Y, & Nie S. (2019). LncRNA SLCO4A1-AS1 predicts poor prognosis and promotes proliferation and metastasis via the EGFR/MAPK pathway in colorectal cancer. International Journal of Biological Sciences, 15(13), 2885-2896.

+ Open protocol

+ Expand

Quantitative RT-PCR for Mouse IL-17A

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNAs were isolated using a QIAGEN RNeasy kit according to the manufacturer’s instructions (QIAGEN) or TRIzol (Thermo Fisher SCIENTIFIC). After reverse transcription into cDNA with a Reverse Transcription Kit (Bio-Rad), qPCR was then performed on Bio-Rad CFX Connect™ Real-time system (Bio-Rad) using SYBR Green (Bio-Rad) and gene-specific primers were listed as follows: mouse IL-17A (Mm_Il17a_SG, QIAGEN) were purchased from QIAGEN; other primers were described in the Key Resources Table. Mouse gene expression level was normalized to mouse β−2 microglobulin (β-MG) housekeeping gene and represented data as fold differences by the 2^−ΔΔCt method, where ΔCt = Ct(target gene)-Ct(β-MG) and ΔΔCt = ΔCt(induced)-ΔCt(reference).

Cai Y., Xue F., Qin H., Chen X., Liu N., Fleming C., Hu X., Zhang H.G., Chen F., Zheng J, & Yan J. (2019). Differential Roles of the mTOR-STAT3 Signaling in Dermal γδ T Cell Effector Function in Skin Inflammation. Cell reports, 27(10), 3034-3048.e5.

+ Open protocol

+ Expand

Gene Expression Analysis by RT-qPCR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from fresh or frozen tissues by homogenization in TRIzol Reagent as previously described (Zhu et al., 2017 (link)). We used 0.5 μg RNA to transcribe cDNA with a reverse transcription kit (Bio-Rad). Most of RT-qPCR primers were from Harvard PrimerBank (https://pga.mgh.harvard.edu/primerbank/). The relative expression levels were calculated using the comparative threshold cycle method, normalized to the housekeeping gene Rps16.

Zhao S., Zhu Y., Schultz R.D., Li N., He Z., Zhang Z., Caron A., Zhu Q., Sun K., Xiong W., Deng H., Sun J., Deng Y., Kim M., Lee C.E., Gordillo R., Liu T., Odle A.K., Childs G.V., Zhang N., Kusminski C.M., Elmquist J.K., Williams K.W., An Z, & Scherer P.E. (2019). Partial Leptin Reduction as an Insulin Sensitization and Weight Loss Strategy. Cell metabolism, 30(4), 706-719.e6.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted with Trizol reagent (Invitrogen) as described in the manufacturer protocols. Extracted RNA was transcribed to cDNA with a Reverse Transcription Kit (Bio-Rad). qRT-PCR reaction was performed using SYBR Green Supermix (Bio-Rad) with the relevant primers (Table S1) and the reaction was detected on MyiQ single color RT-PCR detection system (Bio-Rad). The change in gene expression was quantified by measuring the change in threshold (ΔΔCT), where ΔCt= Ct _{target gene}-Ct _{House keeping gene} and ΔΔCt= ΔCt _induced- ΔCt _reference. All primer sequences were listed in the Supplemental Table 2.

Albeituni S.H., Ding C., Liu M., Hu X., Luo F., Kloecker G., Bousamra M I.I., Zhang H.G, & Yan J. (2016). Yeast-derived Particulate β-Glucan Treatment Subverts the Suppression of Myeloid-derived Suppressor Cells by Inducing PMN-MDSC Apoptosis and M-MDSC Differentiation to APC in Cancer. Journal of immunology (Baltimore, Md. : 1950), 196(5), 2167-2180.

+ Open protocol

+ Expand

Quantitative RT-PCR for Mouse IL-17A

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Quantification of IRF5 Expression in PBMC

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from peripheral blood mononuclear cells of recipients within 6 months post-transplant, and cDNA was synthesized by reverse transcription kit (Bio-Rad, CA). The expression of IRF5 was detected on ABI 7500 Fast Real-Time PCR System (Applied Biosystems, CA) using iTaq Universal SYBR Green Supermix real-time PCR kit (Bio-Rad, CA). The primer pairs of IRF5 and GAPDH for real-time PCR detection were listed as following; IRF5, forward 5′- GACATCCCCAGTGACAAGCA -3′, reverse 5′- AGAACACCTTGCACTGACACA -3′, and GAPDH, forward 5′-ATGGGGAAGGTGAAGGTCG-3′, reverse 5′-GGGGTCATTGATGGCAACAATA-3′. The real-time PCR procedure included a cDNA denaturation at 95°C for 20 sec, and then 40 cycles of amplification with 10 sec at 95°C and 30 sec at 58°C, following with a melt-curve analysis. The relative expression of IRF5 mRNA was calculated by ΔΔCT method.

Yu X., Wei B., Dai Y., Zhang M., Wu J., Xu X., Jiang G., Zheng S, & Zhou L. (2014). Genetic Polymorphism of Interferon Regulatory Factor 5 (IRF5) Correlates with Allograft Acute Rejection of Liver Transplantation. PLoS ONE, 9(4), e94426.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!