Cells in above cardiomyogenic co-culture wells were separately loaded with the acetoxymethyl ester form of fluo-4 (5 μmol/L, Life Technologies) for 30 minutes at room temperature (23°C). A modified tyrode solution was added to excess, to stop the loading process (29 (link)). The cells were then left to de-esterify in an incubator at 37°C for 30 minutes. Each well was examined using an Olympus IX51 fluorescence microscope and images acquired using Volocity imaging software (Perkin Elmer). hHPs were identified by the presence of CM-Dil dye emitting at 570nm (red channel) whilst calcium bound fluo-4 fluorescence was detected at 506nm and recorded (green channel).
Volocity imaging software
Manufactured by PerkinElmer
Sourced in United States, United Kingdom
Volocity is an advanced imaging software solution developed by PerkinElmer. It provides a comprehensive set of tools for visualizing, analyzing, and managing high-content, high-resolution microscopy data.
Automatically generated - may contain errors
Lab products found in correlation
Fluo 4, by Thermo Fisher Scientific (3 mentions)
Wavefx spinning disk, by Quorum Technologies (3 mentions)
Lsm 710, by Zeiss (3 mentions)
Spinning disk ultraview ers, by Olympus (2 mentions)
Ix73 inverted microscope, by Olympus (2 mentions)
Fura 2, by Thermo Fisher Scientific (2 mentions)
Fluo 4, by PerkinElmer (2 mentions)
Spinning disk confocal microscopy at 40x, by PerkinElmer (2 mentions)
Metafluor flourescence ratio imaging software, by Olympus (2 mentions)
Wavefx spinning disk confocal microscope system, by Quorum Technologies (2 mentions)
Prolong gold, by Thermo Fisher Scientific (2 mentions)
Hepes, by Thermo Fisher Scientific (2 mentions)
Calcein green, by Thermo Fisher Scientific (2 mentions)
Dmirb inverted microscope, by Leica (2 mentions)
Cell f software, by Olympus (2 mentions)
Colcemid, by Merck Group (1 mentions)
Lsm 710 microscope, by Zeiss (1 mentions)
Alexa 488, by Thermo Fisher Scientific (1 mentions)
Goat anti mouse igg, by Thermo Fisher Scientific (1 mentions)
Ultraview vox spinning disc confocal microscope, by PerkinElmer (1 mentions)
48 protocols using volocity imaging software
1
Cardiomyocyte Calcium Imaging Protocol
2
Metaphase Preparation and Telomere FISH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Metaphase preparation from ESCs and MEFs was as previously described (Li & Wang, 2011 (link)), but with minor modification. Briefly, ESC or MEF cultures were treated with 1 μg/ml colcemid (Sigma-Aldrich) for 3 h before harvesting. The procedure of telomere FISH with FAM-labeled TelG probe (Eurogentec, Cologne, Germany) followed the protocol outlined by DAKO. Chromosome metaphase and telomere FISH images were captured with a Zeiss M1 microscope (Zeiss, Jena, Germany) and analyzed with Volocity Imaging software (PerkinElmer, Waltham, MA, USA).
3
Quantitative Colocalization Analysis of Polyplexes
4
Quantifying BBB Integrity via IgG Extravasation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The BBB integrity was considered by measuring the parenchymal abundance of, IgG using semi-quantitative confocal immunomicroscopy as described previously [34 (link)-36 (link)]. Briefly, after blocking with 10% goat serum, 20 μm cryosections were incubated with goat anti-mouse IgG conjugated with Alexa488 (1:50, LifeTechnologies) for 20 h at 4°C. The sections were counterstained with DAPI. A minimum of eight and five 3-D images were captured randomly from the cortex and hippocampal formation region of the brain section, respectively with UltraVIEW Vox spinning disc confocal microscope (PerkinElmer). Total image area captured and quantified represented approximately 60% of the hippocampal formation and cortex. The voxel intensity of fluorescence of each 3-D image was analyzed with Volocity imaging software (PerkinElmer), and averaged within each region by using all eight or five 3-D images to estimate the representative voxel intensity per region per mouse. Then the mean voxel intensity of IgG extravasation was calculated within each treatment group (n = 6). The parenchymal staining of IgG was specifically selected and staining within the blood vessels were excluded based on pre-set threshold parameters of Volocity and thereafter confirmed for each image to ensure proper selection by identifying the nucleus of BBB endothelial cells.
5
Quantitation of Protein Colocalization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitation of the colocalization was performed using Volocity imaging software (Perkin Elmer, UK). Quantitation was carried out for the indicated number of cells at each time point. All analyses included samples from two or more independent experiments. Data are expressed as mean ± SEM or mean ± SD, as indicated, and analyzed by an unpaired, two-tailed Student’s t test. p < 0.05 (*) was considered significant, p < 0.01 (**) was highly significant, and p < 0.001 (***) and p < 0.0001 (****) were very highly significant. The absence of a p-value indicates that the differences were not significant (n.s.).
6
Immunofluorescence Analysis of IL-5Rα and Stat5 Activation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tumor cells were grown overnight on glass chamber slides coated with poly-L-lysine (Thermo Fisher). Cells were washed and fixed with 4% paraformaldehyde for 20 min on ice. The cells were incubated overnight at 4 °C with a polyclonal IL-5Rα antibody (Bioss). Cells were washed and then incubated for 1 h at room temperature with an Alexa Fluor secondary antibody, Alexa Fluor 488 conjugated phalloidin and DAPI (Thermo Fisher). Cells were images using a Zeiss LSM 710 confocal microscope. For Stat5 activation studies, cells were treated with IL-5 (BioLegend) for 5 or 15 min prior to fixation and then incubated with phosphorylated Stat5 primary antibody (Cell Signaling Technology, Danvers, MA). Mean fluorescent intensity for phosphorylated Stat5 was calculated by Volocity imaging software (PerkinElmer, Waltham, MA) for nuclear phospho-Stat5 for each cell in the field (~ 7–15 cells for 5–10 fields). Data represents three individual experiments.
7
Visualizing EGFP-tagged Constructs and Ubiquitin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For visualization of EGFP-tagged constructs, cells grown on glass coverslips were fixed with 4% (w/v) paraformaldehyde in phosphate-buffered saline (PBS) at 4°C for 10 min, then washed with PBS and counterstained with DAPI Nucleic Acid Stain (Invitrogen). For ubiquitin labeling, N2a cells were fixed in methanol for 10 min at −20°C, re-hydrated with PBS for 10 min and blocked for 30 min in 5% (w/v) bovine serum albumin with 0.3% (w/v) Triton X-100 in PBS at room temperature. Immunocytochemistry was performed using monoclonal antibody recognizing ubiquitin (mAb1510; Chemicon) at 1:1000 diluted in PBS. Antibody distribution was visualized by epifluorescence microscopy after incubation with secondary antibody conjugated to Alexa 594 diluted at 1:350 in PBS (Molecular Probes), and finally counterstained with DAPI Nucleic Acid Stain. Labeled cells were visualized using a Leica DM6000 microscope and digital images captured using Volocity imaging software (PerkinElmer).
8
Yeast Two-Hybrid Screening Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MATa strains expressing VN-fusion proteins and MATα cells expressing VC-fusion proteins were mated on YPD plates and grown overnight at 30°C, and diploids were selected by growth on SD −ura +G418 plates. The resulting diploids were grown to mid-logarithmic phase in YPD, and live cells were imaged by using Volocity imaging software (PerkinElmer) controlling a Leica DMI6000 confocal fluorescence microscope.
9
Brightfield Microscopy Imaging Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Slides were analyzed using bright-field LM with and without bromophenol blue staining. Images were captured using Volocity imaging software from Perkin Elmer (Walthman, MA, USA). Images had their brightness adjusted using ImageJ to facilitate analysis.
10
Campylobacter Detection by FISH and Neutrophil Elastase
Check if the same lab product or an alternative is used in the 5 most similar protocols
Campylobacter jejuni and thermophilic Campylobacter spp. probes were used in combination with a FISH probe designed to detect feline neutrophil elastase mRNA. The feline neutrophil elastase probe 5′CAGAGGCTGCTGAACGACATCGTGATTCTCCAGCTCAAT3′ was used concurrently with Campylobacter spp. probes (Thermophilic Campylobacter spp. 5′GCCCTAAGCGTCCTTCCA 3′ and C. jejuni 5′AGCTAACCACACCTTATACCG 3′).
Slides were viewed under fluorescence using a DMRB microscope (Leica) equipped with a Retiga EXi camera (QImaging) and Volocity imaging software (PerkinElmer) and searched for the expression of feline neutrophil elastase and Campylobacter. Images were taken when a field of view (×400 objective) contained a neutrophil elastase expressor and one or both of the Campylobacter expressors. A record was made of any neutrophil elastase expressors that did not have a Campylobacter expressor in the same field, as well as the overall presence of C. jejuni and thermophilic Campylobacter. Image J software (http://rsb.info.nih.gov/ij ) was used after images had been captured to allow automated measurement of the distance between two points selected by the user—neutrophil and Campylobacter. The distance was measured in pixels on the digital images. The maximum field size used was 1850 pixels. The use of this software allowed multiple accurate measurements to be taken and compiled for statistical analysis.
+ Expand
Campylobacter jejuni and thermophilic Campylobacter spp. probes were used in combination with a FISH probe designed to detect feline neutrophil elastase mRNA. The feline neutrophil elastase probe 5′CAGAGGCTGCTGAACGACATCGTGATTCTCCAGCTCAAT3′ was used concurrently with Campylobacter spp. probes (Thermophilic Campylobacter spp. 5′GCCCTAAGCGTCCTTCCA 3′ and C. jejuni 5′AGCTAACCACACCTTATACCG 3′).
Slides were viewed under fluorescence using a DMRB microscope (Leica) equipped with a Retiga EXi camera (QImaging) and Volocity imaging software (PerkinElmer) and searched for the expression of feline neutrophil elastase and Campylobacter. Images were taken when a field of view (×400 objective) contained a neutrophil elastase expressor and one or both of the Campylobacter expressors. A record was made of any neutrophil elastase expressors that did not have a Campylobacter expressor in the same field, as well as the overall presence of C. jejuni and thermophilic Campylobacter. Image J software (
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!