Peqgold gel extraction kit

A sample of peripheral venous blood was collected from each participant and genomic DNA was extracted from the white blood cells using the Qiagen Blood‐Midi kit (Qiagen Science Inc., Germantown, MD), following the manufacturer's protocol. Primers to amplify all coding exons of the human GATA4, GATA5, and GATA6 genes were designed using the Primer3 software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) in the intronic regions (Table S1). Amplification by polymerase chain reaction (PCR) was done using the Phusion polymerase high‐fidelity master mix (F‐548S) on a Pico machine (Finnzymes, Espo, Finland). The amplicons were resolved on a 1.5% agarose gel. Purification from gel was performed using the Gel Extraction kit following the manufacturer's protocol (peqGOLD Gel Extraction Kit, PeqLab, Erlangen, Germany). The purified bands were quantified using a NanonDrop (Thermo Fisher Scientific Inc., Waltham, MA) and examined by gel electrophoresis to ensure quality.

For analysis of the BRAF^V600E mutation 3 μm thick FFPE tissue sections were deparaffinized in xylol, proteins were digested and DNA was subsequently extracted in the QIAcube using the QIAamp DNA FFPE Tissue Kit (QIAGEN). PCR was performed as previously described [48 (link)], using the following primers: forward 5′aaactcttcataatgcttgctctg3′ and reverse 5′ggccaaaaatttaatcagtgga3′PCR products were separated on an agarose gel, purified using the peqGold gel extraction kit (Peqlab) and sequenced in a capillary automatic sequencer (Applied Biosystems 96-cappilary 3730xl).

RNA was extracted from serum and tissue samples, saliva, feces, cultured cells or virus cell culture supernatant using the QIAamp Viral RNA Mini Kit and the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. RNA was eluted in 60 µL RNase free distilled water and directly used for RT-PCR or stored at –80 °C for subsequent analysis. RT-PCR was carried out using the OneTaq One-Step RT-PCR Kit (NEB, Ipswich, USA) or the One Step RT-PCR Kit (Qiagen) using the oligonucleotides PPF 5′-GTKATHCAATACCCTGARGC-3′ and PPR 5′-GGRTTCCAGGARTACATCA-3′ [6 (link)]. PCR amplicons were subjected to gel electrophoresis and purified with the peqGOLD Gel Extraction Kit (Peqlab, Erlangen, Germany), if needed.

Chromosomal DNA of R. eutropha H16 was isolated according to the method of Marmur ([1961 (link)]). Plasmid DNA was isolated by using the peqGOLD Plasmid Miniprep Kit (Peqlab) according to the manufacturer’s manual. PCRs were carried out in an Omnigene HBTR3CM DNA thermal cycler (Hybaid, Heidelberg Germany) using genomic DNA of R. eutropha H16 as a template, oligonucleotides (Table 1) and Taq-DNA polymerase according to the manufacturer’s instructions (Thermo Scientific, Dreieich, Germany). The oligonucleotide annealing temperature was 56°C, and the elongation time at 72°C was 2.5 min. PCR products were isolated from an agarose gel and were purified by using a peqGOLD Gel Extraction Kit (Peqlab) according to the manufacturer’s instructions. T4 DNA Ligase was purchased from Thermo Scientific (Dreieich, Germany). Oligonucleotides were synthesized by Eurofins MWG (Ebersberg, Germany). Sequencing reactions of DNA fragments were carried out according to a standard procedure at the Sequence Laboratories Göttingen GmbH (Göttingen, Germany). Competent cells of E. coli were prepared and transformed with plasmids by the CaCl₂ procedure as described by Hanahan (Hanahan [1983 (link)]).

Peripheral venous blood was collected from each participant and genomic DNA was extracted from white blood cells using the Qiagen Blood-Midi kit (Qiagen Science Inc., Germantown, MD), as previously described^{39 (link)}. Primers to amplify all coding exons were designed using the as per the genome.ucsc.edu PCR design. Amplification by polymerase chain reaction (PCR) was done using the Phusion polymerase high-fidelity master mix (F-548S) on a Pico machine (Finnzymes, Espo, Finland), and the amplicons were resolved on a 1.5% agarose gel. Gel purification was performed using the Gel Extraction kit following the manufacturer’s protocol (peqGOLD Gel Extraction Kit, PeqLab, Erlangen, Germany). The purified bands were quantified using a NanonDrop (Thermo Fisher Scientific Inc., Waltham, MA) and examined by gel electrophoresis to ensure quality. DNA sequencing was carried out on an ABI 3500 machine at the molecular core facility at the American University of Beirut, followed by analysis using the data collection software from Applied Biosystems Inc. (Foster City, CA).