Total RNA extraction was performed with TRIzol reagent (TaKaRa, Tokyo, Japan), and was followed by the synthesis of first-strand complementary DNA (cDNA) using a Bestarq PCR RT Kit (DBI Bioscience, Ludwigshafen, Germany). For PCR amplification, 1 µg DNA template was used with primers purchased from Sangon (Shanghai, China) and DBIBestar® SYBRGreen qPCR master Mix (DBI Bioscience). PCR amplification was conducted on an Agilent Stratagene Mx3000P Real-time PCR machine (DBI Bioscience) with the following reaction cycles: 95 °C for 2 minutes; 94 °C for 20 seconds, 58 °C for 20 seconds, and 72 °C for 20 seconds, for 40 cycles. Relative expression levels were calculated using the 2−ΔΔCt method, with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) serving as an internal control. The sequence of primers used was CDK5 forward: 5'-GGAAGGCACCTACGGAACTG-3', CDK5 reverse: 5'-GGCACACCCTCATCATCGT-3'.
Dbi bestar sybrgreen qpcr master mix
Manufactured by DBI Bioscience
Sourced in China
The DBI Bestar® SybrGreen qPCR Master Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) analysis. It contains all the necessary components, including a DNA polymerase, buffer, dNTPs, and the SybrGreen dye, which binds to double-stranded DNA and emits fluorescence upon excitation.
Automatically generated - may contain errors
Lab products found in correlation
Bestar qpcr rt kit, by DBI Bioscience (7 mentions)
Stratagene mx3000p real time pcr system, by Agilent Technologies (4 mentions)
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Trizol reagent, by Takara Bio (2 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Stratagene mx3000p real time pcr platform, by Agilent Technologies (1 mentions)
Trizol method, by Thermo Fisher Scientific (1 mentions)
7500 fast real time pcr system light cycler, by Thermo Fisher Scientific (1 mentions)
Quantstudio 6 flex real time pcr system, by Thermo Fisher Scientific (1 mentions)
10 protocols using dbi bestar sybrgreen qpcr master mix
1
Real-time qPCR for CDK5 Expression
2
Quantitative RT-PCR Protocol for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative RT-PCR was performed as described previously [20 (link)]. Briefly, total RNA was isolated using Trizol (Invitrogen, USA). Total RNA (1 μg) was reverse-transcribed into cDNA using the Bestar™ qPCR RT Kit (DBI Bioscience, China). The qRT-PCR reaction was conducted in a total volume of 20 μl containing 10 μl DBI Bestar® SybrGreen qPCR Master Mix (DBI Bioscience), cDNA derived from 0.2 μg of input RNA, 5 pM of each primer, and 7 μl double-distilled H2O. PCR reactions were carried out using a Stratagene Mx3000P Real-Time PCR system (Agilent Technologies, USA) with the following steps: pre-denaturation at 95 °C for 2 min, followed by 40 cycles of 94 °C for 20 s, 58 °C for 20 s, and 72 °C for 30 s. Each reaction was performed three times. Fold differences in cDNA level relative to the GAPDH level were calculated using the 2−ΔΔCt method. The following primers were used: IL-2Rα sense, 5′-AAATGACCCACGGGAAGAC-3′; IL-2Rα antisense, 5′-TTGTGACGAGGCAGGAAGT-3′; LMP1 sense, 5′-CAACAACGGCAAGACTCCC-3′; LMP1 antisense, 5′-CCTCAAAGAAGCCACCCTC-3′).
3
Gene Expression Analysis in Cultured Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from tissues and cells after 48 h cultivation was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, U.S.A.) according to the manufacturer’s instructions. cDNA was synthesized from 1 μg of total RNA by using the Bestar qPCR RT Kit (DBI Bioscience, Ludwigshafen, Germany). Real-time PCR was performed on Stratagene Mx3000P Real time PCR platform (Agilent Technologies, New Castle, DE, U.S.A.) using total volume of 20 μl DBI Bestar® SybrGreen qPCR master Mix (DBI Bioscience, Ludwigshafen, Germany). The Β-actin was used as an internal control. Each sample was run in triplicate in three independent experiments. Relative quantification was determined by the method of 2−ΔΔCt. The primer sequences were as follows: COL1A1 (forward: 5′-GACGAAGACATCCCACCAATC-3′ and reverse: 5′-GGAGACCACGAGGACCAGAG-3′), COL3A1 (forward: 5′-GCTGGCATCAAAGGACATCG-3′ and reverse: 5′-CAACACCACCACAGCAAGGA-3′), TIMP-1 (forward: 5′-GGGGACACCAGAAGTCAACC-3′ and reverse: 5′-GCATTCCTCACAGCCAACAG-3′), matrix metalloproteinase (MMP)-3 (MMP-3) (forward: 5′-CCCTGATGTCCTCGTGGTA-3′ and reverse: 5′-GGTCCTGAGAGATTTTCGC-3′), Cyclin D1 (forward: 5′-CCCTCGGTGTCCTACTTC-3′ and reverse: 5′-TTTGCGGATGATCTGTTTGT-3′) and c-fos (forward: 5′-CCGAAGGGAAAGGAATAAGA-3′ and reverse: 5′-TGCTGGGAACAGGAAGTCA-3′).
4
Quantifying Gene Expression via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol method (Invitrogen, Carlsbad, CA, USA) was applied for isolating cellular RNA. Through reverse transcription of RNA, the extracted complementary deoxyribose nucleic acid (cDNA) was used for PCR detection using the DBI Bestar SybrGreen qPCR Master Mix (DBI Bioscience, Shanghai, China) on Stratagene Mx3000P Real-Time PCR system (Agilent Technologies, Santa Clara, CA, USA). Glyceraldheyde 3-phosphate dehydrogenase (GAPDH) was used as the internal reference. Cox-2: 5′-ATTGCTGGCCGGGTTGCTGG-3′ (F), 5′-TCAGGGAGAAGCGTTTGCGGT-3′ (R); GAPDH: 5′-TCCCTCAAGATTGTCAGCAA-3′ (F), 5′-AGATCCACAACGGATACATT-3′ (R).
5
Quantitative RT-PCR Protocol for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cultured cells and tumor tissues (human and mice) was extracted using TRIzol reagent (TaKaRa, Tokyo, Japan). The first-strand cDNA was reverse-transcribed (Bestar qPCR RT Kit, DBI Bioscience, Ludwigshafen, Germany) and used as a DNA template (1 μg) for PCR amplification. Primers were synthesized by Sangon (Shanghai, China) and are listed in Table 1 . Amplification was performed using the DBI Bestar® SybrGreen qPCRmasterMix (DBI Bio-science) on an Agilent Stratagene Mx3000P Real-time PCR machine (DBI Bioscience). The following reaction conditions were used: predegeneration at 95°C for 2 minutes, followed by 40 cycles of 94°C for 20 seconds, 58°C for 20 seconds, and 72°C for 20 seconds. Relative expression level was calculated using the 2−∆∆Ct methods with normalization to GAPDH or β-actin.
6
Quantification of PD-L1 Expression via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR analysis was performed to quantify RNA expression of PD-L1. RNA level of GAPDH was measured and used as the internal control. Total RNA of NKTert and HS5 cells from control and experimental groups was extracted using Trizol reagent (Invitrogen, USA). One microgram of the total RNA was reversely transcribed into cDNA using Bestar™ qPCR RT Kit (DBI Bioscience, China). The qRT-PCR reaction was prepared in a total volume of 20 μl containing 10 μl DBI Bestar® SybrGreen qPCR Master Mix (DBI Bioscience, China), cDNA derived from 0.2 μg of input RNA, 5 pM each primer, and 7 μl double-distilled H2O. The PCR was run on Stratagene Mx3000P Real-Time PCR system (Agilent Technologies, USA). The fluorescent quantity PCR conditions were as follows: pre-denaturation at 95°C for 2 min, followed by 40 cycles of 94°C for 20 s, 58°C for 20 s, and 72°C for 30 s. Human PD-L1 forward primer sequence was: 5′-GGAGCCATCTTATTATGCCTT-3′, its reverse primer sequence was: 5′-TCACTTTGCTTCTTTGAGTTTGT-3′. Human GAPDH forward primer sequence was: 5′-TGTTCGTCATGGGTGTGAAC-3′, its reverse primer sequence was: 5′-ATGGCATGGACTGTGGTCAT-3′.
7
Quantitative PCR Analysis of miR-29b Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-qPCR was performed using 96-well optical plates and a 7500 Fast Real-Time PCR System LightCycler (Applied Biosystems; Thermo Fisher Scientific, Inc.). Each 20 µl PCR reaction included 1 µl reverse transcription product (1:5), 0.5 µl sense primer, 0.5 µl Universal reverse primer, and 10 µl mix buffer (DBI Bestar® Sybr-Green qPCR master mix, DBI Bioscience). Reaction conditions were 94°C for 2 min, followed by 40 cycles of 94 and 58°C for 20 sec, and 72°C for 20 sec. All reactions were completed in triplicate. Primer sequences were miR-29b forward: 5′UAGCACCAUUUGAAAUCAGUGUU3′ and reverse: 5′CTCAACTGGTGTCGTGGA3′; and U6 forward: 5′CTCGCTTCGGCAGCACA3′; and reverse: 5′AACGCTTCACGAATTTGCGT3′.
8
Quantifying PD-L1 and LMP1 mRNA in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to quantify PD-L1 and LMP1 mRNA, total RNA was isolated from SNK-6 and NK-92 cells using TRIZOL Reagent (Invitrogen, USA) according to the instruction manual. One microgram of the total RNA was reversely transcribed into cDNA using Bestar™ qPCR RT Kit (DBI Bioscience, China). The qRT-PCR reaction was prepared in a total volume of 20 μl containing 10 μl DBI Bestar® SybrGreen qPCR Master Mix (DBI Bioscience, China), cDNA derived from 0.2 μg of input RNA, 5 pM each primer, and 7 μl double-distilled H2O. The PCR was run on Stratagene Mx3000P Real-Time PCR system (Agilent Technologies, USA). The fluorescent quantity PCR conditions were as follows: pre-denaturation at 95 °C for 2 min, followed by 40 cycles of 94 °C for 20 s, 58 °C for 20 s, and 72 °C for 30 s. Primers were as follows: PD-L1 forward 5′-GAACTACCTCTGGCACATCCT-3′, PD-L1 reverse 5′-CACATCCATCATTCTCCCTTT-3′; LMP1 forward 5′-CAACAACGGCAAGACTCCC-3′, LMP1 reverse 5′-CCTCAAAGAAGCCACCCTC-3′. Each reaction was replicated three times. The fold changes in cDNA relative to the GAPDH endogenous control were calculated using the 2−ΔΔCt method [39 (link)].
9
Quantitative Analysis of miRNAs and circRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from peripheral blood using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The concentration was then measured using an ultratrace UV analyser. RNA was reverse transcribed into cDNA according to the Bestar qPCR RT Kit instructions. PCR amplification was then performed with DBI Bestar® SYBR Green qPCR Master Mix (DBI Bioscience, Shanghai, China) using a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). The expression levels of miRNAs and circRNAs were normalized against U6 or GAPDH expression, and relative quantification was performed using the 2−ΔΔCt method. Primers are shown in Table 2 .
Primer sequences.
| Gene | Sequence(5’-3’) |
|---|---|
| GAPDH | F:TGTTCGTCATGGGTGTGAAC |
| R:ATGGCATGGACTGTGGTCAT | |
| CircRNA-ZCCHC14 | F:TTTGCGGTCATCAGACTTCCT |
| R:TTGCCACAGCATTCTGAAACA | |
| U6 | F:CTCGCTTCGGCAGCACA |
| R:AACGCTTCACGAATTTGCGT | |
| miR-181a | F:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACTCACCG |
| R:ACACTCCAGCTGGGAACATTCAACGCTGTCG |
10
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from PC-12 cells and spinal cord tissues by using Trizol reagent following the manufacturer's protocols. The samples were reversely transcribed by using the Bestar qPCR RT kit (DBI Bioscience, Ludwigshafen, Germany). qPCR ampli cation was carried out by using DBI Bestar ® SybrGreen qPCR MasterMix (DBI Bioscience) under the following conditions: 94 ℃ for 2 min, followed by 40 cycles of 94 ℃ for 20 s, 58 ℃ for 20 s, and 72 ℃ for 20 s. GAPDH was used as a endogenous control, and the relative transcript levels were calculated using the 2 -ΔΔCT method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!