The largest database of trusted experimental protocols

The PET101 is a compact and versatile laboratory instrument designed for the analysis of positron-emitting radionuclides. It provides accurate and reliable measurements of radioactivity levels in various samples. The PET101 utilizes advanced detection technologies to ensure precise and reproducible results, making it a valuable tool for researchers and professionals in the field of nuclear medicine and radiochemistry.

Automatically generated - may contain errors

4 protocols using pet101

1

Cloning and Expression of β-galactosidase Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols
The β-galactosidase BAD_1582 (bgaC) gene sequence of B. adolescentis ATCC15703 was used to design cloning primers for PCR (CACCATGGCAGATACAGCCGAACTC and GAACAGCTTGAGCTGAACGTTGAG). With fosmid clone 31 as template, Velocity DNA polymerase (Bioline) was used to generate a blunt end product (25 cycles: 30 s at 98 °C, 30 s at 63 °C, 1 min and 30 s at 72 °C). PCR products were isolated by DNA gel purification using Promega Wizard R SV gel and PCR clean-up system following the manufacturer’s instructions. The purified blunt end DNA was cloned into expression plasmid pET101 (Invitrogen) following the directional cloning kit protocol. pET101 harbouring the bgaC gene was transformed into the expression host E. coli T7 express lacZ cells (Qin et al. 2010 (link)); the resulting clone was named E. coli T7express (pDMg1a). The primers ACGTATGCCTCGAATCG and CATATTTGGATAGCTC were used to determine the presence of bgaC in fosmids by PCR using Taq DNA polymerase (Bioline), followed by visualisation of the PCR products by agarose gel electrophoresis.
+ Open protocol
+ Expand
2

Expression and Purification of Non-Lipidated rOspC

Check if the same lab product or an alternative is used in the 5 most similar protocols
B. burgdorferi s. s. OspC cDNA (corresponding to GenBank Acc. No. EF537426), lacking the first 54 nucleotides, coding for a lipidation signal, was isolated originally from Borrelia burgdorferi s. s. B31 plasmid DNA preparation, obtained using a Qiagen plasmid purification kit (Qiagen, Hilden, Germany) according to the manufacturer's recommended modification for Borrelia plasmid DNA, by RT-PCR.
The PCR product of the reaction performed with downstream adapter primer (CACCATGTGTAATAATTCAGGGAAAGATGGG) und upstream primer (AGGTTTTTTTGGACTTTCTGCC) and Phusion DNA polymerase (New England BioLabs, Ipswich, MA) was cloned into E. coli expression plasmids pET101 and pET200 (Invitrogen) in order enable the expression of non-lipidated rOspC fusion proteins with a V5-tag and a C' terminal His-tag or an Xpress-tag with N' terminal His-tag. N' and C' terminal His-tag rOspC variants were purified under native conditions using the Ni-NTA agarose (Qiagen) as described earlier [15 (link)] with modified lysis buffer: (50 mM Tris; 300 mM NaCl; 10 mM Imidazole; 1 mg/ml hen egg white lysozyme; 0,1% Triton X-100; protease inhibitors: 0.2 mM PMSF; 0.4 μg/ml Leupeptin; 0.5 μg/ml Aprotinin; pH8.0). Subsequently, the proteins were dialyzed against Tris-HCl storage buffer (50 mM Tris, 150 mM NaCl, pH7.5).
+ Open protocol
+ Expand
3

Purification and Antibody Generation of ATRX

Check if the same lab product or an alternative is used in the 5 most similar protocols
A fragment of human ATRX protein corresponding to nucleotides 7072–7671 was cloned into pet101 (Invitrogen Cat#K10101) following manufacturer’s instructions. ATRX protein was expressed in BL21 star (Thermo Fisher cat#C601003) using standard protein expression procedures and purified using Ni-NTA agarose (Qiagen cat#30210) under native conditions. Purified protein was dialyzed into 1× PBS and used for antibody generation (Cocalico Biologicals, Inc).
ATRX antibodies were affinity purified from serum. Briefly, purified ATRX-His antigen was coupled to NHS-activated agarose (Pierce cat#26200) according to manufacturer’s instructions. Antigen coupled beads and 1 ml of serum were incubated overnight at 4 °C on a rotating wheel. Beads were washed 2× with 4 column volumes (CV) PBS, 2× with 4CV PBS containing 0.5 M NaCl, and 1× with 4CV PBS. The antibody was eluted with 5CV (1CV at a time) of 0.1 M glycine pH 2.5 directly into tubes containing 10% volume of 1.5 M Tris pH 8.8. Glycerol was added to purified antibody and aliquots were stored at −20 °C.
+ Open protocol
+ Expand
4

Kinetic Analysis of SB3-PreS1AuNP Interaction

Check if the same lab product or an alternative is used in the 5 most similar protocols
SPR analyses were
performed using a double channel Biacore X100 instrument (GE Healthcare,
Uppsala, Sweden). Recombinant SB3 was produced after cloning human
SB3 cDNA in the directional expression vector pET101 (Invitrogen Carlsbad,
CA), as previously described.41 (link) A dextrane-coated
gold chip (CM5) was activated by flowing a 1:1 mixture of 0.2 M N-ethyl-N-(3-(dimethylamino)propyl) carbodiimide
and 0.05 M N-hydroxysuccinimide in water. A continuous
flow of HEPES pH 7.4 was maintained. SB3 (50 μg/mL) in 10 mM
sodium acetate (pH 5) was immobilized on the activated chip surface
at a flow rate of 10 μL/min to obtain an immobilization level
of “Response Bound” of 1661 RU and “Response
Final” of 1840 RU. Excess of activated carboxylic groups on
the chip was blocked with ethanolamine. The control channel was treated
following the same protocol without protein immobilization. Kinetic
assays were performed with both PreS1AuNPs and 1-AuNP as the control,
following the instrument built-in standard protocol using HBS-EP+
buffer at pH 7.4 (0.1 M HEPES, 1.5 M NaCl, 30 mM EDTA, and 0.5% v/v
P20 surfactant) by subsequent 180 s injections of nanoparticle solutions
at increasing concentration (0.005–0.157 nM) using NaCl 3 M
as regeneration solution. Details are reported in the Supporting Information.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!