Pfu ultra 2 fusion dna polymerase

Manufactured by Agilent Technologies

Pfu Ultra II Fusion DNA polymerase is a thermostable DNA polymerase enzyme used for high-fidelity DNA amplification. It possesses 3'-5' exonuclease proofreading activity, enabling accurate DNA synthesis with minimal error rates.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Pfu Ultra II HS fusion DNA polymerase Pfu Ultra DNA polymerase Pfu Ultra II polymerase Pfu-Ultra polymerase Pfu DNA polymerase Pfu Ultra II Pfu polymerase

11 protocols using pfu ultra 2 fusion dna polymerase

Genomic DNA Extraction and Sequence Analysis of Plasmodium Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from parasites using the QIAamp blood kit (Qiagen) for sequence analysis of the pfdhodh gene (PlasmoDB code Pf3D7_0603300; GenBank^TM accession number AB070244.1; and NCBI reference sequence XM_960930.1). A 2.2-kb fragment encompassing the complete pfdhodh ORF was PCR-amplified from drug-resistant clones and parental lines (primer sequences below). PCR-amplified fragments were fully sequenced using pfdhodh-specific primers as follows: PfDHODH forward 5′-GATCCCTAGGATGATCTCTAAATTGAAACCTCAATTTATG-3′, PfDHODH reverse 5′-GATACTCGAGTTAACTTTTGCTATGCTTTCGGCCAATG-3′, and PfDHODH internal 5′-CATTATTTGGATTATATGGTTTTTTTGAATCTTATAATCCTG-3′.
The pfdhodh gene was amplified with Pfu Ultra II Fusion DNA polymerase (Agilent) with the following conditions: step 1, 95 °C for 120 s; step 2, 95 °C for 30 s; step 3, 55 °C for 30 s, and step 4, 60 °C for 140 s, go to step two and repeat 30 times. PCR amplicons were purified with a PCR clean-up kit (Qiagen) and sequenced. Cytochrome b (PlasmoDB code mal_mito_3) and cytochrome c oxidase (PlasmoDB code mal_mito_1) were amplified and sequenced with the following primers: Mal_mito_1 forward 5′-GTAATTTATCAAATATAAAAGCACATCTAGTTTC-3′ and Mal_mito_1 reverse 5′-CTGAATAGAATAAGAACTCTATAAATAACCAG-3′; Mal_mito_3 forward 5′-GCTCATGAACTTTTACTCTATTAATTTAGTTAAAGC-3′ and Mal_mito_3 reverse 5′-GATCTTATATGTTTGCTTGGGAGCTG-3′.

Ross L.S., Gamo F.J., Lafuente-Monasterio M.J., Singh O.M., Rowland P., Wiegand R.C, & Wirth D.F. (2014). In Vitro Resistance Selections for Plasmodium falciparum Dihydroorotate Dehydrogenase Inhibitors Give Mutants with Multiple Point Mutations in the Drug-binding Site and Altered Growth. The Journal of Biological Chemistry, 289(26), 17980-17995.

+ Open protocol

+ Expand

Molecular Techniques for DNA Manipulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA manipulations were carried out using standard molecular techniques (Elion et al., 2007 ). DNA was amplified using Pfu Ultra II Fusion DNA polymerase (Agilent) or Phusion High-Fidelity DNA Polymerase (New England Biolabs). Site-directed mutagenesis was performed using the Quikchange™ Site Directed Mutagenesis protocol (Agilent). Plasmids were purified using the Wizard Plus SV Miniprep kit (Promega) and PCR products were purified using the Wizard SV Gel and PCR Clean-Up System (Promega). DNA sequencing was performed at the Georgia Genomics Facility. Primers were synthesized from Integrated DNA Technologies and are listed in Table 2.

VanDrisse C.M, & Escalante-Semerena J.C. (2018). In Streptomyces lividans, acetyl-CoA synthetase activity is controlled by O-serine and Nε-lysine acetylation. Molecular microbiology, 107(4), 577-594.

+ Open protocol

+ Expand

Standard DNA Manipulation Techniques

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA manipulations were performed using standard techniques [23] . Restriction endonucleases were purchased from Fermentas. DNA was amplified using Pfu Ultra II Fusion DNA polymerase (Agilent) or Herculase II Fusion DNA polymerase (Agilent). Site-directed mutagenesis was performed using the Quikchange™ Site Directed Mutagenesis kit (Agilent). Plasmids were isolated using the Wizard Plus SV Miniprep kit (Promega) and PCR products were purified using the Wizard SV Gel and PCR Clean-Up System (Promega). DNA sequencing was performed using BigDye® (ABI PRISM) protocols, and sequencing reactions were resolved at the University of Georgia Genomics Facility.

Tucker A.C, & Escalante-Semerena J.C. (2014). Determinants within the C-Terminal Domain of Streptomyces lividans Acetyl-CoA Synthetase that Block Acetylation of Its Active Site Lysine In Vitro by the Protein Acetyltransferase (Pat) Enzyme. PLoS ONE, 9(6), e99817.

+ Open protocol

+ Expand

Constructing pIL-SVnisBTC and Derivatives

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The plasmid pIL-SVnisBTC was generated from pIL-SV and pIL3BTC^{31 (link)}. The plasmid pIL3BTC was digested with the restriction enzymes NotI (NEB) and BstXI (NEB) to receive a fragment BTC containing the genes nisB, nisT and nisC. Next, pIL-SV^{62 (link)} was also digested with NotI and BstXI (pIL-SV**). The fragment BTC and pIL-SV** were ligated with T4-ligase (NEB) and transformed into E. coli DH5α. The sequence of the construct pIL-SVnisBTC (Table S5) was verified by DNA sequencing (Microsynth Seqlab).
By using Phusion DNA polymerase (NEB) with the appropriate primer pairs (Table S4) the gene deletions of nisB, nisC or nisT were performed to generate pIL-SVnisBTC derivatives. Subsequently, the linearized vectors were ligated with T4-ligase (NEB) and transformed into E. coli DH5α. The sequence of the constructs (Table S5) were verified by DNA sequencing (Microsynth Seqlab).
To generate nisT_H551A and nisC_H331A mutants, a polymerase chain reaction using PfuUltra II Fusion DNA polymerase (Agilent Technologies), the template pIL-SVnisBTC and the appropriate pair of oligonucleotides (Table S4) was performed according to standard procedures. The sequence of the new constructs (Table S5) were verified by DNA sequencing (Microsynth Seqlab).

Lagedroste M., Reiners J., Smits S.H, & Schmitt L. (2020). Impact of the nisin modification machinery on the transport kinetics of NisT. Scientific Reports, 10, 12295.

+ Open protocol

+ Expand

Site-Directed Mutagenesis of Aer2 Receptor

Check if the same lab product or an alternative is used in the 5 most similar protocols

Wild type (WT) Aer2_1–679 and the N-terminal tag encoded by pProEXHTa have no native Cys residues. Full-length Aer2-Cys, R260A, D, K, L264A, D285E, R, and R260D/D285R substituted receptors were created by site-directed mutagenesis using pLH1 with site-specific primers and PfuUltra II Fusion DNA polymerase (Agilent Technologies, Santa Clara, CA). Products were treated with DpnI (New England Biolabs, Ipswich, MA) to remove template DNA and electroporated into E. coli BT3388. Aer2_173–679-Cys and Aer2_173–289-Cys mutants were created by amplifying the coding region for residues 173–679 or 173–289 from individual pHL1-derived Cys mutants and ligating into the NcoI and SalI sites of pProEXHTa. BACTH constructs were created by amplifying the coding region for residues 173–289 from pLH1 and ligating into the XbaI and EcoRI sites of pUT18C and pKT25 to express T18-PAS or T25-PAS. T18 and T25 are two fragments of Bordetella pertussis adenylate cyclase that, when reconstituted, regenerate the active enzyme^{21 (link)}. All mutations were confirmed by sequencing the entire gene. Expression was confirmed by Western blotting with 1:10,000 HisProbe^™-HRP (Thermo Scientific, Rockford, IL) or 1:10,000 anti-CyaA-HRP (for T18-PAS; Santa Cruz Biotechnology, Dallas, TX).

Orillard E., Anaya S., Johnson M.S, & Watts K.J. (2021). Oxygen-induced conformational changes in the PAS-heme domain of the Pseudomonas aeruginosa Aer2 receptor. Biochemistry, 60(34), 2610-2622.

+ Open protocol

+ Expand

Sequencing Library Preparation and Multiplexing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sequencing libraries were prepared by PCR amplification using PfuUltra II Fusion DNA polymerase (Agilent #600672) and primers designed to anneal to the universal primer site flanking the oligos and to add sequencing index barcode for multiplexing: forward caagcagaagacggcatacgagatCGTGATgtgactggagttcagacgtgtgctcttccgatctACTGGCCGCTTCACTG, reverse AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT (capital letters indicate (i) the index for the library, and (ii) the region complementary to the universal primer site). PCR amplification (initial denaturation 95°C—2 min; cycling 95°C—30 s, 55°C—30 s, 72°C—30 s; final extension 72°C—10 min) was carried out for 30 cycles followed by triple 0.6×, 1.6×, and 1× SPRI beads (Agencourt AMPure XP, Beckman Coulter) cleanup. The quality and molarity of the libraries was evaluated by BioAnalyzer, and the samples were sequenced in a pool of 6 on the Illumina HiSeq2500, full flow cell, single‐read 100 bp. To ensure the transfection was successful, we required that at least 70% of the oligo‐pool was represented back (i.e., had a count of at least one) in the sequencing sample (Fig EV1).

Shukla C.J., McCorkindale A.L., Gerhardinger C., Korthauer K.D., Cabili M.N., Shechner D.M., Irizarry R.A., Maass P.G, & Rinn J.L. (2018). High‐throughput identification of RNA nuclear enrichment sequences. The EMBO Journal, 37(6), e98452.

+ Open protocol

+ Expand

Cloning and Mutagenesis of Streptomyces Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

All primers used in this study were synthesized by IDT (Coralville, IA) and are listed in table 4Streptomyces lividans TK24 genomic DNA was used as template to amplify genes lbuL (EFD65795), ibuL (EFD65796), mlaL (EFD68037), paaL (EFD64737), dhbL (EFD64524), EFD64965, couL (EFD67678), and ambL (EFD66106) genes for overproduction using Pfu Ultra II Fusion DNA polymerase (Agilent). The first codon of lbuL (GTG) was changed to the more common ATG start codon. The DNA fragments were digested with NheI and EcoRI and ligated into pTEV5 that directs the synthesis of the recombinant protein fused to a hexa-his (H₆) tag at the N-terminus (Rocco et al., 2008 (link)). Site-directed mutagenesis for constructing active-site lysine variants was performed using the QuikChange protocol (Stratagene) using the plasmid containing the wild-type allele as template. DNA sequencing of resulting plasmids was performed at the Georgia Genomics and Bioinformatics Core at the University of Georgia.

Burckhardt R.M., VanDrisse C.M., Tucker A.C, & Escalante-Semerena J.C. (2019). New AMP-forming acid:CoA ligases from Streptomyces lividans, some of which are posttranslationally regulated by reversible lysine acetylation.. Molecular microbiology, 113(1), 253-269.

+ Open protocol

+ Expand

Mutagenesis of Baculovirus gp64 Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

The plasmids of IA^g7-KS20 and IA^g7-SG20 containing the transmembrane-cytoplasmic tail of the baculovirus gp64 protein were used as templates for mutation. The primers were used for mutation in Supplementary Table S1. Site-directed mutagenesis experiments were carried out using PfuUltra II fusion DNA polymerase (Agilent Technologies). The PCR reaction system is 50 μL: 5 μL of 10× reaction buffer, 50 ng of DNA template, 1 μL of 10 μM forward and reverse primer, 1 μL of dNTP, 1 μL of PfuUltra II, 3 μL of dimethyl sulfoxide (DMSO), and water added to the final volume of 50 μL. The temperature program used was 1 min at 95°C followed by 18 cycles of 50 s at 95°C, 50 s at 60°C, and 8 min at 68°C. The PCR product was digested with 1 μL DpnI (R0176L, NEB) for 2 h and transformed to competent DH5α.

Li W., Li R., Wang Y., Zhang Y., Tomar M.S, & Dai S. (2022). Calcitonin gene-related peptide is a potential autoantigen for CD4 T cells in type 1 diabetes. Frontiers in Immunology, 13, 951281.

+ Open protocol

+ Expand

Illumina Library Prep for DNA Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Library preparation was done similar to Blecher-Gonen et al. (41 (link)) with some changes. Briefly, Sonicated DNA was subjected to a 50 μl end repair reaction using 1 μl End repair mix (E6050L, NEB), cleaned by 1.8× Ampure XP beads, followed by a 50μl A-tail reaction using 2 μl Klenow fragment exo- (M0212L, NEB). The products were cleaned by 1.8× beads and were ligated by 2 μl quick ligase (M2200, NEB) to 0.75 μM illumina compatible forked indexed adapters. Ligation products were size selected by 0.7× PEG (considering the PEG in the ligation buffer) in order to remove free adaptors. 12–19 cycles of amplification were performed by PFU Ultra II Fusion DNA polymerase (600670, Agilent) with the following Primers:

P7 5′AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC 3′,

P5 5′ CAAGCAGAAGACGGCATACGAGAT 3′.

Amplified DNA was size selected for 300–700 bp fragments by taking the supernatant after using 0.5× beads (which removed fragments greater than 700 bp) followed by a 1.0× beads cleaning (which removed remaining primers and adapter dimers). The final quality of the library was assessed by Qubit and TapeStation. Libraries were pooled and sequenced on NextSeq (illumina) for 75 bp paired-end sequencing, generating 10M reads per each library.

Yehuda Y., Blumenfeld B., Mayorek N., Makedonski K., Vardi O., Cohen-Daniel L., Mansour Y., Baror-Sebban S., Masika H., Farago M., Berger M., Carmi S., Buganim Y., Koren A, & Simon I. (2018). Germline DNA replication timing shapes mammalian genome composition. Nucleic Acids Research, 46(16), 8299-8310.

+ Open protocol

+ Expand

Illumina Library Preparation Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Library preparation was carried out as described^{45 (link)}. Briefly, sonicated DNA was subjected to a 50 µl end repair reaction using 1 µl End repair mix (NEB, #E6050L), cleaned by 1.8 × Ampure XP beads, followed by a 50-µl A-tail reaction, using 2 µl Klenow fragment exo-nuclease (NEB, #M0212L). Products were cleaned by 1.8 × beads and ligated by 2 µl quick ligase (NEB, #M2200) to 0.75 µM Illumina compatible forked indexed adapters. Ligation products were size selected by 0.7 × PEG (considering the PEG in the ligation buffer) in order to remove free adapters. 12–19 cycles of amplification were performed by PFU Ultra II Fusion DNA polymerase (Agilent, #600670) with the following Primers:
P7: 5’ AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGAC 3’; P5: 5’ CAAGCAGAAGACGGCATACGAGAT 3’. Amplified DNA was size selected for 300–700 bp fragments by taking the supernatant after using 0.5 × beads (which removed fragments greater than 700 bp), followed by a 1.0 × cleaning to remove remaining primers and adapter dimers. The final quality of the library was assessed by Qubit and TapeStation. Libraries were pooled and sequenced on NextSeq (Illumina) by 75 bp paired-end sequencing, generating ~10 M reads per library.

Blumenfeld B., Masika H., Farago M., Yehuda Y., Halaseh L., Vardi O., Rapoport R., Levin-Klein R., Cedar H., Bergman Y, & Simon I. (2021). Chromosomal coordination and differential structure of asynchronous replicating regions. Nature Communications, 12, 1035.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!