Extracellular viral RNA was isolated from 150 μl supernatant using the NucleoSpin RNA virus kit (Macherey-Nagel, Düren, Germany), while the intracellular viral RNA was isolated using the Cells-to-cDNA™ lysis buffer (Life Technologies, Bleiswijk, The Netherlands). The sequences of primers and probe used in qRT-PCR were described before [18 (link)]: forward primer 5′-CCGACTCAACCATCCTGGAT-3′, reverse primer 5′-GGCAGACGCAGTGGTACTTCCT-3′, probe 5′-FAM-TCCGACATCATCCTCCTTGCTGGC-TAMRA. The one-step, quantitative RT-PCR was performed in a total volume of 25 μl, containing 13.94 μl H2O, 6.25 μl master mix (Eurogentec, Belgium), 0.375 μl of forward primer, 0.375 μl of reverse primer (final concentration of each primer 150 nM), 1 μl of probe (final concentration 400 nM), 0.0625 μl reverse transcriptase (Eurogentec, Belgium) and 3 μl RNA sample. The reaction was quantified using the Applied Biosystems 7500 Fast Real-Time PCR System (Branchburg, NJ, USA) using the following conditions: 30 min at 48°C and 10 min at 95°C, followed by 40 cycles of 15 s at 95°C and 1 min at 60°C. For quantification, standard curves were generated each run using 10-fold dilutions of a CHIKV standard cDNA.
Reverse transcriptase
Manufactured by Eurogentec
Sourced in Belgium
Reverse transcriptase is an enzyme that catalyzes the conversion of single-stranded RNA into complementary DNA (cDNA). It plays a crucial role in the process of reverse transcription, which is essential for various molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
7500 fast real time pcr system, by Thermo Fisher Scientific (2 mentions)
Cells to cdna lysis buffer, by Thermo Fisher Scientific (1 mentions)
Nucleospin rna virus kit, by Macherey-Nagel (1 mentions)
Abi 7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Abi prism 7500 sds software, by Thermo Fisher Scientific (1 mentions)
3 protocols using reverse transcriptase
1
Quantifying Chikungunya Virus RNA
2
Quantitative RT-PCR for MAYV Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequences of primers used in qRT-PCR were: forward primer: 5′-TGGACCTTTGGCTCTTCTTATC-3′, reverse primer: 5′-GACGCTCACTGCGACTAAA-3′ (Integrated DNA Technologies (IDT), Leuven, Belgium) [24 (link)]. The probe sequence was 5′-/56-FAM/TACTTTCCTGCTGCAAGGGCTCTT/3BHQ_1/−3′ (IDT) [24 (link)]. One-step, quantitative RT-PCR was performed in a total volume of 25 µL, containing 13.94 µL H2O, 6.25 µL master mix (Eurogentec, Seraing, Belgium), 0.375 µL of forward primer, 0.375 µL of reverse primer (final concentration of each primer 150 nM), 1 µL of probe (final concentration 400 nM), 0.0625 µL reverse transcriptase (Eurogentec) and 3 µL RNA sample. The qRT-PCR reaction was performed with the Applied Biosystems 7500 Fast Real-Time PCR System (Branchburg, NJ, USA) using the following conditions: 30 min at 48 °C, 10 min at 95 °C, followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C. For quantification, standard curves were generated each run using 10-fold dilutions of MAYV viral RNA isolated from the virus stock.
3
Multiplex Detection of Arboviral Pathogens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DENV primers and probe sequences were as follows:
DENV-Rev 5'-TCTTAACGTCCGCCCATGAT-3', DENV-Probe FAM-5'-ATTCCACACAATGTGGCAT-MGB-3' 30 ; CHIKV primers and probe sequences were as follows: ChikSII 5'-CCGACTCAACCATCCTGGAT-3', ChikAsII 5'-GGCAGACGCAGTGGTACTTCCT-3' and ChikProbe 5'-FAM-TCCGACATCATCCTCCTTGCTGGC-TAMRA-3' 31 ; and YFV primers and probe sequences were as follows: YFV-For 5'-TGGCATATTCCAGTCAACCTTCT-3', YFV-Rev 5'-GAAGCCCAAGATGGAATCAACT-3' and YFV-Probe FAM-5'-TTCCACACAATGTGGCATG-MGB-3' 30 . Onestep, qRT-PCR was carried out, containing 1× of master mix (Eurogentec, Seraing), 900 nM of forward primer, 900 nM of reverse primer, 200 nM of probe, 0.125 U/mL of reverse transcriptase (Eurogentec), 10 to 100 ng of RNA template, and RNAse free water. qRT-PCR was carried out using the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Branchburg) under the following conditions: 30 min at 48 O C and 10 min at 95 O C, followed by 40 cycles of 15 s at 95 O C and 1 min at 60 O C. Data were analyzed using the ABI PRISM 7500 SDS software (version 1.3.1; Applied Biosystems). For absolute quantification, standard curves were generated using 10-fold dilutions of template preparation of known concentrations.
DENV-Rev 5'-TCTTAACGTCCGCCCATGAT-3', DENV-Probe FAM-5'-ATTCCACACAATGTGGCAT-MGB-3' 30 ; CHIKV primers and probe sequences were as follows: ChikSII 5'-CCGACTCAACCATCCTGGAT-3', ChikAsII 5'-GGCAGACGCAGTGGTACTTCCT-3' and ChikProbe 5'-FAM-TCCGACATCATCCTCCTTGCTGGC-TAMRA-3' 31 ; and YFV primers and probe sequences were as follows: YFV-For 5'-TGGCATATTCCAGTCAACCTTCT-3', YFV-Rev 5'-GAAGCCCAAGATGGAATCAACT-3' and YFV-Probe FAM-5'-TTCCACACAATGTGGCATG-MGB-3' 30 . Onestep, qRT-PCR was carried out, containing 1× of master mix (Eurogentec, Seraing), 900 nM of forward primer, 900 nM of reverse primer, 200 nM of probe, 0.125 U/mL of reverse transcriptase (Eurogentec), 10 to 100 ng of RNA template, and RNAse free water. qRT-PCR was carried out using the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Branchburg) under the following conditions: 30 min at 48 O C and 10 min at 95 O C, followed by 40 cycles of 15 s at 95 O C and 1 min at 60 O C. Data were analyzed using the ABI PRISM 7500 SDS software (version 1.3.1; Applied Biosystems). For absolute quantification, standard curves were generated using 10-fold dilutions of template preparation of known concentrations.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!