The Mcl-1 gene silencing efficiency in BT474 was evaluated by reverse transcription polymerase chain reaction (RT-PCR) after single and dual treatment for 48 h. The mRNA was extracted and reverse transcripted to cDNA using the SuperPrep™ II Cell Lysis and RT Kit for qPCR (Toyobo, Osaka, Japan). Quantitative real-time PCR was quantified using the Thunderbird™ SYBR® qPCR Mix (Toyobo, Osaka, Japan) on a LightCycler® 480 Instrument II (Roche, Basel, Switzerland). The specific primers for glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and Mcl-1 were designed from NM_001357943.2 and NM_021960.5, respectively. The GAPDH forward primer was TTTTGCGTCGCCAGCCG. The GAPDH reverse primer was CGCCCAATACGACCAAATCC. The Mcl-1 forward primer was GGA-GACCTTACGACGGGTT. The Mcl-1 reverse primer was AGTTTCCGAAGCATGCCTTG. The mRNA expression level was calculated by comparing the threshold cycle of Mcl-1 with GAPDH. The relative expression quantity was reported by comparing the targeted group with the untreated group.
Superprep 2 cell lysis and rt kit for qpcr
Manufactured by Toyobo
Sourced in Japan
The SuperPrep II Cell Lysis and RT Kit for qPCR is a laboratory product designed for the preparation of RNA samples and reverse transcription prior to quantitative PCR (qPCR) analysis. The kit provides reagents and protocols for cell lysis, RNA extraction, and reverse transcription in a streamlined workflow.
Automatically generated - may contain errors
3 protocols using superprep 2 cell lysis and rt kit for qpcr
1
Mcl-1 Gene Silencing Efficiency in BT474 Cells
2
qRT-PCR Analysis of TNF-α Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Preparation of cell lysates and reverse transcription were performed using SuperPrep II Cell Lysis and RT Kit for qPCR (TOYOBO). Real-time PCR was carried out using KOD SYBR qPCR Mix (TOYOBO). qRT-PCR primers used were as follows; TNF-α: 5′- CAGCCTCTTCTCCTTCCTGAT (forward), 5′-GCCAGAGGGCTGATTAGAGAGA (reverse); GAPDH: 5′-AGCAACAGGGTGGTGGAC (forward), 5′- GTGTGGTGGGGGACTGAG (reverse).
3
Quantitative RT-PCR for SpCas9 and GAPDH Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted from stable SpCas9-expressing SH-SY5Y cells and cDNA was synthesized using the SuperPrep II Cell Lysis and RT Kit for qPCR (Toyobo, SCQ-401). For quantitative RT-PCR, primer sets were synthesized with Eurofin genomics. The specific primers used to amplify SpCas9 were 5′-GAAGAGAACCGCCAGAAGAAG-3′ and 5′-CCACGATGTTGCCGAAGAT-3’. The primers used to amplify hGAPDH were 5′-GACTCATGACCACAGTCCATG-3′ and 5′-TCAGCTCAGGGATGACCTTG. Quantitative RT-PCR was performed using Thunderbird SYBR qPCR Mix (Toyobo, QPS201), and results were analyzed on a real-time PCR system (7500 Fast Real-Time PCR System; Life Technologies, Inc.). In addition, to confirm the specificity of the amplification, we performed a quantitative PCR program followed by a melting curve analysis and agarose gel electrophoresis of the PCR products.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!