Total RNA in tissues and cells was extracted using Trizol kits (Invitrogen) and reversely transcribed into cDNA using reverse transcriptase (Epicentre, WI, USA) or the miS-cript Reverse Transcription Kit (Qiagen). cDNA amplification was performed using the SYBR Premix Ex Taq (Takara, Dalian, China) and the PCR was conducted using Applied Biosystems 7900HT PCR system with β-actin as the internal reference. Primers are shown in Supplementary Table 2 and data were analyzed using the 2–ΔΔCt method.
Reverse transcriptase
Manufactured by Illumina
Sourced in United States
Reverse transcriptase is an enzyme that catalyzes the synthesis of complementary DNA (cDNA) from a single-stranded RNA template. It is a critical component in various molecular biology techniques, including gene expression analysis, RNA sequencing, and reverse transcription-PCR (RT-PCR).
Automatically generated - may contain errors
Lab products found in correlation
Miscript reverse transcription kit, by Qiagen (2 mentions)
Sybr premix ex taq, by Takara Bio (2 mentions)
Oligo dt magnetic beads, by Illumina (2 mentions)
Dna polymerase 1, by Illumina (2 mentions)
Rnaseh, by Illumina (2 mentions)
7900ht pcr system, by Thermo Fisher Scientific (1 mentions)
Trizol kit, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Rnase inhibitor, by Illumina (1 mentions)
Pcr master mix, by Qiagen (1 mentions)
Oligo dt 18 primer, by Thermo Fisher Scientific (1 mentions)
Hiseq 2000 platform, by Illumina (1 mentions)
Random hexamer primers, by Illumina (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
6 protocols using reverse transcriptase
1
RNA Extraction, Reverse Transcription, and qPCR
2
Quantitative RT-PCR Analysis of RNA and miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RNA extraction, the fresh tissues and cells were lysed using TRIzol reagent (Invitrogen) and purified using RNeasy Mini Kit (Qiagen, Valencia, CA, USA). Complementary DNA was synthesized using reverse transcriptase (Epicentre, Madison, WI, USA) or the miS-cript Reverse Transcription Kit (Qiagen) and then amplified using SYBR Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan). The mRNA and miRNA levels were determined by the 2−ΔΔCt method, with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 as internal controls, respectively. The primers used for PCR amplification were as follows: for TGF-βR1, 5′-ACTGGCAGCTGTCATTGCTG GACCAG-3′ (forward) and 5′-CTGAGCCAGAACCTGACGTTGTCATATCA-3′ (reverse); for GAPDH, 5′-TGCACCACCAACTGCTTAGC-3′ (forward) and 5′-GGC ATGGACTG TGGTCATGAG-3′ (reverse); for miR-101, 5′-CGGCGGTACAGTACT GTGATAA-3′ (forward) and 5′-CTGGTGTCGTGGAGTCGGCAATTC-3′ (reverse); and for U6, 5′-CTCGCTTCGGCAGCACA-3′ (forward) and 5′-AACGCTTCACGA ATTT GCGT-3′ (reverse).
3
Detecting miRNA Expression in Silicosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To verify the array results, we collected another 3 observation subjects and 6 patients with stage I and stage II silicosis using RT-qPCR to detect the expression of hsa-miR-181c-5p and hsa-miR-29a-3p. Total RNA (150 ng), 1 μM RT primer (Table 2 ), 10×RT buffer, 2.5 mM each of dATP, dGTP, dCTP and dTTP (HyTest Ltd., Turku, Finland), 200 U/μl reverse transcriptase (Epicentre, Palmerston North, New Zealand) and 40 U/μl RNase Inhibitor (Epicentre, Palmerston North, New Zealand) were subjected to reverse transcriptase reactions. PCR master mix (Qiagen, Hilden, Germany) and 0.6 μM of each primer (Table 1 ) were used for RT-qPCR. Each experiment was performed in triplicate.Oligonucleotides used in the study
| Primer set name | reverse transcriptase reaction primer | Real-time quantitative PCR primer |
|---|---|---|
| U6 | 5’CGCTTCACGAATTTGCGTGTCAT3’ | F:5’GCTTCGGCAGCACATATACTAAAAT3’ |
| R:5’CGCTTCACGAATTTGCGTGTCAT3’ | ||
| hsa-miR-181c-5p | 5’GTCGTATCCAGTGCGTGTCGTGGAGTC | GSP:5’ GGGAACATTCAACCTGTCG3’ |
| GGCAATTGCACTGGATACGACACTCAC3’ | R:5’GTGCGTGTCGTGGAGTCG3’ | |
| hsa-miR-29a-3p | 5’ GTCGTATCCAGTGCGTGTCGTGGAGTC | GSP:5’ GGGGTAGCACCATCTGAAAT3’ |
| GGCAATTGCACTGGATACGACTAACCG3’ | R:5’GTGCGTGTCGTGGAGTCG3’ |
4
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from different cancer cell lines using TRI reagent. First strand cDNA was synthesized from 1 µg of RNA with reverse transcriptase (Epicentre) and oligo (dT)18 primer (Fermentas) at 37°C for 2 h. PCR was done using isoform speci c primer pairs.
5
RNA-seq Library Preparation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To obtain poly (A) mRNA from the total RNA, oligo (dT) magnetic beads were used (Illumina). The RNA was broken down into short fragments by the addition of fragmentation buffer. These short fragments were then used as templates for first-strand cDNA synthesis with random hexamers and reverse transcriptase (Illumina). To synthesize the second strand of the cDNA, a solution of RNase H (Illumina), DNA polymerase I (Illumina), dNTPs, and buffer was used. The ends of the resulting double-stranded cDNA fragments were repaired, and adapters were ligated. The final version of the cDNA library was prepared from these products by purification and subsequent amplification by PCR. Using the Illumina Hiseq 2000 platform, the four prepared cDNA libraries were sequenced, resulting in 100-bp paired-end reads.
6
RNA Sequencing Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from each PF or SF sample group was extracted with TRIzol reagent (TaKaRa, Dalian city, China) according to the manufacturer's instructions, and purity and degradation were checked on 1% agarose gels. DNA was removed from the RNA extracts by incubation with RNase-free DNase for 30 min at 37°C.
A cDNA library was constructed and oligo (dT) magnetic beads (Illumina) were employed to isolate Illumina sequencing poly(A) mRNA isolated from total RNA. The purified mRNA was broken into short fragments using a fragmentation buffer. Random hexamer primers and reverse transcriptase (Illumina) were used to perform first-strand cDNA synthesis using the short fragments as templates. Second-strand cDNA was synthesized using RNase H (Illumina), DNA polymerase I (Illumina), dNTPs and buffer. These cDNA fragments were subjected to an end-repair process and ligation to adapters. These products were purified and enriched with PCR to create the final cDNA library.
A cDNA library was constructed and oligo (dT) magnetic beads (Illumina) were employed to isolate Illumina sequencing poly(A) mRNA isolated from total RNA. The purified mRNA was broken into short fragments using a fragmentation buffer. Random hexamer primers and reverse transcriptase (Illumina) were used to perform first-strand cDNA synthesis using the short fragments as templates. Second-strand cDNA was synthesized using RNase H (Illumina), DNA polymerase I (Illumina), dNTPs and buffer. These cDNA fragments were subjected to an end-repair process and ligation to adapters. These products were purified and enriched with PCR to create the final cDNA library.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!