Zymo quick rna columns

RNA was extracted and purified from GFP+ sorted FLCs, 72 h post-infection, using Zymo Quick-RNA columns (Zymo Research, Irvine, CA). Barcoded, Illumina-stranded total RNA libraries were prepared using the TruSeq Stranded Total RNA Sample Preparation Kit (Illumina, San Diego, CA). Briefly, 250 ng of DNase I-treated total RNA was depleted of cytoplasmic and mitochondrial ribosomal RNA (rRNA) using Ribo-Zero Gold (Illumina, San Diego, CA). After purification, RNA was fragmented using divalent cations and double stranded cDNA was synthesized using random primers. The ends of the resulting double stranded cDNA fragments were repaired, 5′-phosphorylated, 3’-A tailed, and Illumina-specific indexed adapters were ligated. The products were purified and enriched by 12 cycles of PCR to create the final cDNA library. The libraries were quantified by qPCR and assessed for size distribution using the 4200 TapeStation High Sensitivity D1000 ScreenTape (Agilent Technologies, Santa Clara, CA) then multiplexed three libraries per lane and sequenced on the Illumina HiSeq4000 sequencer (Illumina, San Diego, CA) using the 75 bp paired end format. The RNA-sequencing experiments were done in 3 biological replicates of FLCs infected with EV (n = 3) and hnRNP K plasmid (n = 3). The data has been deposited to Array Express (E-MTAB-11886).

RNA from OCI-AML3 cells was extracted using Zymo Quick-RNA columns (Zymo Research, Irvine, CA). Purified RNA was reverse transcribed using the iScript cDNA Synthesis kit (BioRad) to generate cDNA. qRT-PCR was performed with iTaq Universal SYBR Green SMX as per instructions on an ABI StepOnePlus Real Time PCR System. All assays were performed in triplicate. Changes in expression were compared using the Pfaffl method (33 (link)) by comparing expression changes between target genes and the housekeeping control (PPIA and RPLP0). Primers used were RUNX1 Exon4/5 forward primer (detects full length): CAGATGCAGGATACAAGGCAGATC, RUNX1 Exon3/5 forward primer (detects RUNX1 ΔEx4 isoform): AACCTCGAAATACAAGGCAGATC, RUNX1 universal reverse primer: TCGACTGGAAAGTTCTGC, PPIA forward: CCCACCGTGTTCTTCGACATT, PPIA reverse: GGACCCGTATGCTTTAGGATGA, RPLP0 forward: CCTTCTCCTTTGGGCTGGTCATCCA and RPLP0 reverse: CAGACACTGGCAACATTGCGGACAC.