Thunderbird probe

Total RNA was abstracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Complementary DNA (cDNA) was amplified using ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan). The protocol was conducted with the following cycling parameters: at 37°C for 15 mins, and at 98°C for 5 mins for 40 cycles. All quantitative reverse transcription polymerase chain reaction (RT-qPCR) examinations were performed using 96-microwell plates in a 7300 Real-Time PCR System (Applied Biosystems, Foster city, CA, USA). The RT-qPCR amplification was conducted in a 20 μl final reaction volume using THUNDERBIRD Probe and SYBR qPCR Mix (Toyobo, Osaka, Japan) according to the manufacturer’s instructions. Quantifications were normalized by taking β-actin as an internal reference and were calculated by using the 2^ΔΔCt method. Primer sequences were as follows:
CD166 forward, 5’- ACTTGACGTACCTCAGAATCTCA −3’;
and reverse, 5’- CATCGTCGTACTGCACACTTT −3’;
β-actin forward, 5’-AGAGCTACGAGCTGCCTGAC-3’;
and reverse, 5’-AGCACTGTGTTGGCGTACAG-3’.

A raw EBN sample (rEBN) was purchased from Surat-Thani, Thailand. Aiko Edible Bird Nest Pattani Part., Ltd. (Thailand) provided the processed EBN powder (pEBN). Thermo Fisher Scientific K.K. (Japan) supplied the RPMI 1640 medium and Dulbecco's Modified Eagle Medium (DMEM). FITC anti-mouse MHC-II, FITC anti-mouse CD80, and FITC anti-mouse CD86 were purchased from eBioscience, Inc. (USA). FITC anti-mouse CD3ε antibody, PE anti-mouse CD19 antibody, anti-mouse CD16/32 antibody, and recombinant mouse IL-2 were purchased from BioLegend, Inc. (U.S.A.). Falcon® 70 μm Cell Strainer was purchased from Corning, Inc. (USA). Fetal bovine serum (FBS), l-Glutamine, Penicillin-Streptomycin, and β-mercaptoethanol were purchased from Nacalai Tesque, Inc. (Japan). The filter paper was purchased from ADVANTEC Co., Ltd., Japan). THUNDERBIRD™ - Probe and SYBR® were purchased from Toyobo Co., Ltd., JAPAN.