Silica bead dna gel extraction kit

For DNA sequencing of cagL genes, 25 µL PCRs using specific primers CagL‐B4 (5′ GCAGAATTCATAACAAGCGGCTTAAAG 3′) and CagL‐B5 (5′ ATTAGAATTCATAGCCTATCGTCTCAG 3′) generated 695 bp PCR amplicons. The PCR products were purified using the Silica Bead DNA Gel Extraction Kit (Thermo Scientific, Fermentas, USA). The partial nucleotide sequences of cagL genes from 46 strains characterized in this study were deposited in the GenBank database; accession numbers are shown in Table 1.

Seven DNA samples that were previously positive for G. paralysans and two positives for A. abstrusus were randomly selected for sequencing analysis. The purification of the PCR products was carried out following the manufacturer’s instructions, using the Silica Bead DNA Gel Extraction^® kit (Thermo Scientific, Waltham, MA, USA). The results obtained were evaluated using the biological sequence editing software BioEdit Version 7.0.9.0, and the Basic Local Alignment Search Tool (BLAST) available at NCBI (National Center for Biotechnology Information).

Bacterial isolates were randomly picked from plates with 20–100 colonies obtained after plating a serial dilution of the RMT on the R2A medium and incubation at 28°C for 6 days. Genomic DNA was extracted from 10 representative RMT isolates using the Genomic DNA Extraction Kit (Qiagen, Hilden, Germany) and the Silica Bead DNA Gel Extraction Kit (Thermo Fisher Scientific, Waltham, MA, United States). A BOX-PCR fingerprint was conducted for each isolate (Martin et al., 1992 (link)) and taxonomic affiliation was determined based on sequencing (Macrogen Europe B.V., Amsterdam, Netherlands) of a partial 16S rRNA gene fragment (Heuer et al., 2009 (link)). The sequences were trimmed and assembled using CLC MainWorkbench 20.0.3 (Qiagen, Aarhus, Denmark) and taxonomic affiliation was determined based on the NCBI database (NCBI, Bethesda, MD, United States).
Bacterial isolates of the RMT were tested in vitro for potential plant beneficial activities: protease, β-1,3-glucanase, and cellulase (Weinert et al., 2010 (link)), as well as chitinase activity (Berg et al., 2001 (link)). Further assays tested for ACC deaminase and IAA production (Koo et al., 2010 (link)), production of siderophores (Schwyn and Neilands, 1987 (link)), and AHLs using the sensor strains Chromobacterium violaceum VIR07 and cv026 (Durán et al., 2016 (link)).

Positive controls of P. falciparum and P. malariae DNA were used in the amplification reactions of the cPCR to produce the insert for cloning, with the same pair of primers as used in the qPCR reaction [22 (link)]. Briefly, the total volume of the reaction was 50 μl, with 4 μl of DNA, 32.75 μl of sterilized ultrapure water, 1× Taq buffer (10 mM of Tris-HCl at pH 8.3 and 50 mM of KCl), 0.8 mM of deoxynucleotide triphosphates, 2 mM of MgCl₂, 0.2 μM of the primers M60 and M61, and 1.25 U of Platinum Taq (Life Technologies®). The reaction started with a cycle at 95 °C for 10 min, followed by 32 amplification cycles of 94 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s.
The 84 bp fragments were observed on 2% agarose gel. They were then purified using the Silica Bead DNA Gel Extraction Kit (Thermo Scientific®, São Paulo, Brazil) and were cloned using the pGEM-T Easy Vector System (Promega®), following the manufacturer’s recommendation. The binding products were transformed into Escherichia coli One Shot Match 1TM Chemically Competent Cells (Life Technologies®). Plasmid DNA was extracted using the QIAprep Miniprep Kit (Qiagen®).

For DNA sequencing of cagI and cagN, PCR amplification was carried out in a final volume of 25 µl using designed specific primers including 5′-CATTTGACTTACCTTGATTAC-3′ (cagI-F) and 5′-TTTGAGCACTTGTTGGTTGG-3′ (cagI-R), 5′-GAGCGACAAAACAACTATGC-3′ (cagN-F) and 5′-GATCCCTAGAACAAAGTAAGC-3′ (cagN-R) yielding DNA fragments of about 1377 and 1192 bp in length, respectively. The PCR products were purified using the Silica Bead DNA Gel Extraction Kit (Thermo Scientific, Fermentas, USA) followed by sequencing on both strands using an automated sequencer (Macrogen, Seoul, Korea). DNA sequences were edited by Chromas Lite version 2.5.1 (Technelysium Pty Ltd, Australia) and BioEdit version 7.2.5²⁹ . The cagI and cagN nucleotide and amino acid sequences were aligned to H. pylori strain P12 as a reference strain (GenBank: CP001217.1). The single nucleotide variations and codon usage of the sequences were examined using BioEdit version 7.2.5.

For DNA sequencing, PCR amplification was performed in a reaction mixture of 25 µl using primers agrD-CpF and agrD-CpR, yielding amplicons of approximately 292 bp in length. PCR products were purified using the Silica Bead DNA Gel Extraction Kit (Thermo Scientific, Fermentas, USA) followed by sequencing of both forward and reverse strands using an automated sequencer ABI 3730XL (Macrogen, Seoul, Korea). DNA sequences were edited using Chromas Lite v2.5.1 (Technelysium Pty Ltd, Australia) and BioEdit v7.2.5³⁴ . All the complete agrD nucleotide and amino acid sequences were aligned to the agrD sequence of C. perfringens reference strain FORC_025 (CP013101.1, toxinotype A) as a scaffold sequence after in-frame translation. Single nucleotide variations and amino acid polymorphism of the translated sequences were examined using BioEdit v7.2.5.