Ready to go you prime first strand beads kit

RNA was isolated out of lung biopsies of the right lung lobe using the RNeasy Minikit (Qiagen; Hilden, Germany). For reverse transcription, 2 µg RNA was used with RevertAid First Strand cDNA synthesis kit (ThermoScientific, Waltham, MA, USA), or Ready-To-Go You-Prime First-Strand Beads kit (GE; Boston, MA, USA). qRT-PCR was performed like described before (24 (link)). Primers specific for sense orientation of OVA expression cassette were used (AAGAGTCAAATGGCTCTCCTCAAGCGTATT and GTCTGTTGTGCCCAGTCATAGCCGAATAG). OVA expression was related to expression of lung tissue-specific surfactant protein C (Spc) gene (CACCATCGCTACCTTTTCCA and CTCGGAACCAGTATCATGCC). As indicated, in some experiments GAPDH was used as reference housekeeping gene [primers provided in RevertAid First Strand cDNA synthesis kit (ThermoScientific, Waltham, MA, USA)].

Total RNA was extracted from the cells using the RNeasy kit (QIAGEN, Hilden, Germany). Cells were seeded on 10 cm-diameter dishes until 80-90% confluency was attained. On the day of the experiment, the medium was removed, and the cells were washed with 5 mL PBS, followed by addition of lysis solution, per the manufacture’s recommended procedure. Template DNA was prepared with extracted total RNA of each sample using Ready-To-Go You-Prime First-Strand Beads kit (GE Healthcare, Little Chalfont, UK) and 0.5 μL each of 1st strand DNA per sample was used for quantitative polymerase reaction (qPCR) with Fast SYBR Green Master Mix reagent (Life Technologies, Carlsbad, CA, USA). Analysis was done after preparing samples in a 96-well plate; signal during PCR was detected by Step One Plus Real-time PCR system (Life Technologies). The primers used are given in Additional file 1: Table S1. β-actin was used as an internal control for normalization of data. Data were analyzed by the software accompanied with the PCR system.