Triquick reagent

BMDCs/tumor-draining lymph nodes were collected. Total RNAs were extracted by Triquick Reagent (Trizol Substitute, Solarbio, China). RNA (500 ng), quantified by NanoDrop2000 (Thermo Fisher Scientific, USA), was reversely transcribed to cDNA using the first-strand cDNA synthesis kit (Vazyme, China). Quantitative PCR was applied using the SYBR Green dye (Vazyme, China) on quant studio 3 applied biosystems (Thermo Fisher Scientific, USA). All primers were synthesized by Tsingke Biotechnology and their sequences were listed in Supplementary Table S1. The parameters of PCR assays were shown as follows: initial denaturation at 95 °C for 30 s, 40 cycles of denaturation at 95 °C for 10 s, and primer annealing and reaction at 60 °C for 30 s. Comparative quantification was assessed using the 2^-ΔΔCt method with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the endogenous control.

RT-qPCR was used to investigate the expression levels of the PI3K-AKT pathway associated genes (COL1A1, COL1A2, COL4A5, FN1, IGF2, and PIK3R1).
Total RNA extraction and cDNA synthesis were performed using the TriQuick Reagent (TRIzol Substitute) (Beijing Solarbio Science & Technology Co., Ltd.) and the UEIris II RT-PCR System for the cDNA Synthesis SuperMix (Beijing TransGen Biotech Co., Ltd.) according to the manufacturers’ instructions. All synthesized cDNA were used for the PCR amplification using the TransStart^® Top Green qPCR SuperMix kit (Beijing TransGen Biotech Co., Ltd.). The total reaction system was 20 μL. The primer sequences used were presented in Table 2 [6 (link)]. GAPDH was used as a normalization control.
The cyclic parameters used were pre-denaturation at 94 °C for 30 s, followed by the PCR reaction (45 cycles of 94 °C for 15 s, 60 °C for 15 s, and 72 °C for 10 s), while fluorescence data were collected at 72 °C. The relative gene expression levels were analyzed using the 2^−ΔΔCT method [31 (link)].

Total RNA from SKOV3 cells was isolated by using TriQuick reagent (R1100, Solarbio) and 5 μg RNA was reverse-transcribed for preparing cDNA by a commercial RT kit (Transgene, AH341). Real-time PCR was performed using the AriaMx Real-Time PCR System with Top Green PCR Master Mix (AQ131-01, TransGen Biotech) and the following primer: TP53 (F:TTTCACCCTTCAGATCCGTG; R:GACTGTCCCTTCTTAGACTTCG), GAPDH(F:CTC CTCCACCTTTGACGCTG, R: TCCTCTTGTGCTCTTGCTGG), GAPDH was used as the internal reference.

Followed by E. coli infection, L. rhamnosus GR-1 was used to pretreat the cells. All treated cells were harvested at 6 h after infection, from which the total RNA was extracted based on Triquick Reagent (Solarbio, Beijing, China) for quantitative analysis via the Nanodrop instrument (Thermo Fisher Scientific, UK). Aided by FastKing-RT SuperMix (Tiangen, Beijing, China), synthesis of cDNA was accomplished from 1 μg of the acquired total RNA. In terms of quantitative real-time PCR, the SuperReal PreMix Plus (Tiangen, Beijing, China) and the subsequent LightCycler 480 system (Roche, Switzerland) were employed. As for the amplification specificity assessment, single-band recognition was performed at the anticipated molecular weight in the DNA agarose gel. Meanwhile, a unimodal peak was identified in the qRT-PCR melting plots. Table 1 lists the primer sequences. Comparative threshold cycle approach was adopted for the computation of the data. Later, the IL-6, IL-8, IL-1β, MyD88, TNF-α, and TLR4 levels were examined.

TriQuick Reagent (Solarbio, R1100, China) was used for RNA extraction according to the manufacturer’s instructions. The Mir-X miRNA First-Strand Synthesis Kit (Takara, 638313, Japan) was used for the reverse transcription of miRNA. TransScript One-Step gDNA removal and cDNA synthesis superMix (TransScript, AT311, China) was used for reverse transcription of circRNA and the coding genes. The TransStart Top Green qPCR SuperMix (TransScript, AQ131, China) and Roche LightCycler 480 II (Roche, Switzerland) were used to perform qRT-PCR. U6 was used as an internal miRNA control and GAPDH was used as an internal control for circRNA, and the coding genes. Experiments were repeated three times independently. The primers are listed in Additional file 1: Table S5. qRT-PCR amplicons were analyzed using agarose gel electrophoresis. The Amersham Imager 680 was used for imaging gels.

Total RNA was extracted with TriQuick reagent (Solarbio, Beijing, China), and cDNA was synthesized according to the instructions of reverse transcription kit (Vazyme, Nanjing, China). The reaction system was prepared for amplification according to the instructions of the RT-PCR kit (Vazyme, Nanjing, China). Amplification conditions were as follows: Pre-denaturation at 95˚C for 30 s, denaturation at 95˚C for 5 s, annealing and extension at 60˚C for 30 s, for a total of 40 cycles. The results were analyzed by the 2^−△△Ct method, and the expression of mRNA was expressed as a ratio to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Primer sequences are shown in Supplementary Table 1.