Quantstudio 7 flex instrument

Manufactured by Thermo Fisher Scientific

Sourced in United States

The QuantStudio 7 Flex is a real-time PCR instrument designed for quantitative analysis of nucleic acid samples. It features a 96-well format and is capable of performing fast, standard, and emulation run methods. The instrument utilizes a peltier-based thermal block for precise temperature control during amplification and detection.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

QuantStudio 7 Flex (372 citations) QuantStudio 7 (209 citations) QuantStudio 7 Flex Real-Time PCR instrument (24 citations) QuantStudio 7 instrument (7 citations) QuantStudio™ 7 Flex Real-Time PCR System instrument (3 citations)

11 protocols using quantstudio 7 flex instrument

Quantifying Gene Expression in BpV-Treated HT22 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HT22 cells were cultured to 70% confluence in culture dishes with 5% CO₂ and 95% air at 37°C. BpV (0.3 or 3 μM) was added for 12 or 24 hours. Total RNA was extracted from HT22 cells with or without BpV treatment using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The concentration and purity of RNA were determined spectrophotometrically by reading the absorbance at 260 and 280 nm. Aliquots (3 µg) of total RNA were reverse transcribed into cDNA using a commercial kit (Invitrogen). Real time-PCR was conducted in triplicate on an ABI 7900 real-time PCR system using PowerUP SYBR green master mix (Thermo Fisher Scientific, San Jose, CA, USA), a Quant Studio 7 Flex instrument, and fast gene-expression method with the following cycling conditions: 95°C for 2 minutes; 40 cycles of 95°C for 30 seconds, 59°C for 30 seconds, and 72°C for 30 seconds; followed by 72°C for 2 minutes. Reactions were carried out in triplicate and β-actin gene expression was used as an internal control to normalize variability in expression levels. The results were analyzed by the 2^-ΔΔCT value method, as previously described (Zhang et al., 2014, 2016). Primers used in this study are shown in Table 1.

Tian X.L., Jiang S.Y., Zhang X.L., Yang J., Cui J.H., Liu X.L., Gong K.R., Yan S.C., Zhang C.Y, & Shao G. (2019). Potassium bisperoxo (1,10-phenanthroline) oxovanadate suppresses proliferation of hippocampal neuronal cell lines by increasing DNA methyltransferases. Neural Regeneration Research, 14(5), 826-833.

+ Open protocol

+ Expand

Quantifying miR-4443 and MMP2 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from tissue samples or cells by TRIzol reagent (Invitrogen, United States), and a NanoDrop ND-2000 spectrophotometer (Thermo Fisher Scientific, United States) was used to measure the concentration and purity of total RNA. Subsequent qRT–PCR was performed using a QuantStudio 7 Flex instrument (Thermo Fisher Scientific, United States). .Reverse transcription of miR-4443 and MMP2 were performed using a miRNA First Strand cDNA Synthesis Kit (Accurate Biology, China) and TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (TransGen, China), respectively. The expression of miR-4443 and MMP2 were examined with SYBR Green Premix Pro Taq HS qPCR Kit (Accurate Biology, China) and were normalized to small nuclear RNA U6 and 18S RNA expression as respective internal reference. Primers for mRNA expression are shown in Table 2. The relative expression levels of miR-4443 and MMP2 were calculated by using the comparative Ct method.Table 2.

Primers used in qRT-PCR analysis.

Genes	Primers	Sequence (5’-3’)
hsa-miR-4443	Forward	GCTTGGAGGCGTGGGTTTTA
	Reverse	^#
U6	Forward	GGAACGATACAGAGAAGATTAGC
	Reverse	TGGAACGCTTCACGAATTTGCG
MMP2	Forward	TACAGGATCATTGGCTACACACC
	Reverse	GGTCACATCGCTCCAGACT
18S	Forward	GTAACCCGTTGAACCCCATT
	Reverse	CCATCCAATCGGTAGTAGCG

^#The 3’ primer of hsa-miR-4443 was provided by the miRNA First-Strand cDNA Synthesis Kit (Accurate Biology, China).

Chen C., Gao J., Chen D., Liu J., He B., Chen Y., Zhang H., Yang X, & Cheng W. (2022). miR-4443/MMP2 suppresses the migration and invasion of trophoblasts through the HB-EGF/EGFR pathway in preeclampsia. Cell Cycle, 21(23), 2517-2532.

+ Open protocol

+ Expand

Thermal Shift Assay for Ligand Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols

For DSF, 0.1 mg/ml TLX-LBD in 20 mM Tris pH 8.0, 150 mM NaCl, 5 mM DTT, 10% Glycerol, 1% CHAPS was mixed with 1X Sypro Orange (ThermoFisher) and either DMSO, 0.1 mM, 1 mM, or 10 mM of test compound and run in triplicate on a 384-well MicroAmp Optical Plate (ThermoFisher). No protein control and no ligand references were also run simultaneously in triplicate on the same plate. Thermal stability was performed on a Quantstudio 7 Flex Instrument (ThermoFisher) and protein melt shifts were quantified by Boltzmann-derived T m using the Protein Thermal Shift (ThermoFisher) software. This experiment was performed twice to validate replication of the data.

Griffett K., Bedia-Diaz G., Hegazy L., de Vera I.M.S., Wanninayake U.S., Billon C., Koelblen T., Wilhelm M.L, & Burris T.P. (2020). The Orphan Nuclear Receptor TLX Is a Receptor for Synthetic and Natural Retinoids. Cell chemical biology, 27(10).

+ Open protocol

+ Expand

Quantitative RT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time quantitative PCR (qPCR) was performed with a Quantstudio 7 flex instrument (Applied Biosystems) using Taqman Fast advanced mastermix (Applied Biosystems) and appropriate taqman probes for the genes of interest. Relative expression was normalized to housekeeping genes (Ppia and Tbp). All taqman probes were purchased from ThermoFisher and are listed in Table 2.Table 2

taqman probes used for qPCR.

Gene	Catalog #
Acta2	Mm00725412
Col1a1	Mm00801666
Col4a1	Mm01210125
Col6a3	Mm00711678
Ctgf	Mm01192933
Fn1	Mm01256744
Inhba	Mm00434339
Itga5	Mm00439797
Mmp11	Mm00485048
Mmp2	Mm00439498
Mmp9	Mm00442991
Serpine	Mm00435858
Sparc	Mm00486332
Tgfb1	Mm01178820
Tgfbr1	Mm00436964
Tgfbr2	Mm03024091
Timp1	Mm01341361
Tnc	Mm00495662

All probes were purchased from ThermoFisher.

Jones J.E., Rabhi N., Orofino J., Gamini R., Perissi V., Vernochet C, & Farmer S.R. (2020). The Adipocyte Acquires a Fibroblast-Like Transcriptional Signature in Response to a High Fat Diet. Scientific Reports, 10, 2380.

+ Open protocol

+ Expand

Transcriptomics analysis of inflammatory gene expression

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from mouse colonic mucosa using TRIzol reagent (Invitrogen, 15596026) and then used for cDNA synthesis with HiScript III RT SuperMix for qPCR (Vazyme, R323-01). Quantitative PCR was performed to quantify the gene expression of pro-inflammatory cytokines and chemokines using 2×Hieff® qPCR SYBR Green Master Mix (No Rox) in QuantStudio 7 Flex instrument (Applied Biosystems). In addition, transcriptomics sequencing (RNA-seq) was performed with an Illumina Novaseq 6000 platform (PE150, Magigene, Guangdong, China), and genes were annotated with HISAT2^{99 (link)} by mapping to the Mus musculus genome (assembly GRCm39). Differentially expressed gene (DEG) analysis was performed with DESeq2^{100 (link)}, and the genes that fulfilled the criteria FDR adjusted p < 0.05 and fold change >2 were considered to be differentially expressed. All of the differentially expressed genes were utilised as the input for Gene Set Enrichment Analysis (GSEA) and Gene Ontology analysis (focus on biological process), and were visualised with ggplot2 R package. The primer pairs for quantitative RT-PCR are shown in Supplementary Table 1.

Cao Z., Fan D., Sun Y., Huang Z., Li Y., Su R., Zhang F., Li Q., Yang H., Zhang F., Miao Y., Lan P., Wu X, & Zuo T. (2024). The gut ileal mucosal virome is disturbed in patients with Crohn’s disease and exacerbates intestinal inflammation in mice. Nature Communications, 15, 1638.

+ Open protocol

+ Expand

Quantification of SMN-1 Transcript Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

Synchronized age-matched animals were collected in M9 buffer at day 1 of adulthood. Animals were washed with M9 buffer four times to remove excess bacteria, and the supernatant was removed after the last wash step. Worms were then frozen at −80°C in 500 µl TRIzol Reagent (Thermo Fisher Scientific). After thawing, worms were homogenized using a 27 gauge ½ inch needle with a syringe, and another 500 µl of TRIzol was added. Samples were incubated at room temperature for 5 min before adding 200 µl of chloroform and letting them sit for an additional 2 min. Samples were then centrifuged at 12,000 g for 15 min to separate the phases. The aqueous phase was collected, and extraction was completed using an RNeasy Mini Kit (Qiagen) and its standard protocol. cDNA was synthesized using a SuperScript VILO cDNA Synthesis Kit (Invitrogen), and real-time PCR was performed, using TaqMan probes and standard TaqMan reagents, to quantify smn-1 transcript levels (probes and reagents were purchased from Applied Biosystems). Cdc-42.1 was chosen as the housekeeping gene. Gene expression assays were run on a QuantStudio 7 Flex instrument (Applied Biosystems) and data analysis was conducted using QuantStudio Real-Time PCR software.

Doyle J.J., Vrancx C., Maios C., Labarre A., Patten S.A, & Parker J.A. (2020). Modulating the endoplasmic reticulum stress response attenuates neurodegeneration in a Caenorhabditis elegans model of spinal muscular atrophy. Disease Models & Mechanisms, 13(12), dmm041350.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation (ChIP) Assay

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chromatin immunoprecipitation (ChIP) was performed as previously described (Zhu et al., 2015 (link)). In brief, cells were crosslinked in 1% formaldehyde (Thermo Scientific 28906) in PBS for 12 min at room temperature. After quenching with 2.5 M glycine, cell pellets were collected and lysed as described (Zhu et al., 2015 (link)), and subjected to chromatin shearing with the Covaris sonicator (E220). The supernatant was then diluted in the same sonication buffer but without N-lauroylsarcosine, and subjected to immunoprecipitation with ATF4 antibody or IgG control at 4°C overnight. The beads were then washed and DNA was reverse-crosslinked and purified (QIAGEN 28106). Following ChIP, DNA was quantified by quantitative PCR (qPCR) using standard procedures on an Applied Biosystems QuantStudio 7 flex instrument. qPCR primers used in this study were listed in Table S1.

Zhu J., Berisa M., Schwörer S., Qin W., Cross J.R, & Thompson C.B. (2019). Transsulfuration activity can support cell growth upon extracellular cysteine limitation. Cell metabolism, 30(5), 865-876.e5.

+ Open protocol

+ Expand

Gene Expression Analysis via RT-qPCR and TaqMan Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with a miRVana isolation kit (Thermo Fisher) and reverse-transcribed to cDNA with a QuantiTect reverse transcription kit (Qiagen) according to the manufacturer’s instructions. cDNA samples synthesized from 1 μg of total RNA were subjected to RT-qPCR with the Applied Biosystems Quant Studio 7 Flex instrument using the iTaq SYBR Green Supermix (Bio-Rad). Relative gene expression was calculated using the ΔΔCT method normalizing the expression to that of a stable reference gene (GAPDH or as stated). We assumed a primer efficiency of 100% (±10%), according to manufacturer’s guidelines. The primers are listed in Table S3.
TaqMan gene expression assays (Fig. 4) were conducted using probes from ThermoFisher listed in Table S4. They were used following manufacturer’s protocols and run on an Applied Biosystems Quant Studio 7 Flex instrument. Data were analyzed as described above.

Cheng J., Tsuda M., Okolotowicz K., Dwyer M., Bushway P.J., Colas A.R., Lancman J.J., Schade D., Perea-Gil I., Bruyneel A.A., Lee J., Vadgama N., Quach J., McKeithan W.L., Biechele T.L., Wu J.C., Moon R.T., Si Dong P.D., Karakikes I., Cashman J.R, & Mercola M. (2021). Small Molecule Probe Reveals a Kinase Cascade that Links Stress Signaling to TCF/LEF and Wnt Responsiveness. Cell chemical biology, 28(5), 625-635.e5.

+ Open protocol

+ Expand

Fluorescence-based Oligo Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Phosphate-buffered saline (PBS, pH 7.4), Tris–EDTA (TE) and Tween 20 were purchased from Sigma-Aldrich. All oligonucleotides (oligos) were synthesized at the 100 nmol scale, dissolved in TE buffer (pH 8.0) to 100 μM and HPLC-purified by Integrated DNA Technologies (IDT). Chemical modifications on oligos were prepared by IDT as well. The concentrations of oligo stocks were verified with Nanodrop (Thermo Fisher), and then diluted to 10 μM in PBS. All oligos were stored in darkness at 4°C. The sequences of all oligos are listed in Supplementary Table S1. Solution fluorescence for TEEM was measured using a QuantStudio 7 Flex instrument (Applied Biosystems). Samples were loaded in MicroAmp Fast Optical 96-Well Reaction Plates, 0.1 ml (Applied Biosystems), and the loaded plate was sealed using MicroAmp Optical Adhesive Film (Applied Biosystems).

Bae J.H, & Zhang D.Y. (2021). Predicting stability of DNA bulge at mononucleotide microsatellite. Nucleic Acids Research, 49(14), 7901-7908.

+ Open protocol

+ Expand

Quantifying LC3A Expression in HeLa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HeLa cells have been plated in a 6-multiwell. Once at 80% confluence, they have been treated with LEU-ME 10mM for 2h. Every well has been lysed in 1mL of TRIsure (BIOLINE, Cat No. BIO-38033) for 5 minutes. Total RNA has been extracted according to manufacturer protocol. 1ug of total RNA has been retrotranscribed with High-Capacity RNA-to-cDNA Kit (Applied Biosystems, REF 4387406), following manufacturer protocol. 2 ng of cDNA has been assayed for LC3A expression through real-time PCR, using SensiFAST SYBR Lo-ROX 2x Mix (Meridian, Cat No. BIO-94020) and the following primers at concentration 400nM:
LC3A: Fw: 5’-GTGAGTGTGTCCACGCCCAT-3’
Rv: 5’-AGGTTTCCTGGGAGGCGTAG-3’
GAPDH: Fw: 5’-GTCGGAGTCAACGGATTTGG-3’
Rv: 5’-AAAAGCAGCCCTGGTGACC-3’.
Real-time PCR has been performed in MicroAmp Fast Optical 96-Well Reaction Plate with Barcode 0.1mL (Applied Biosystems – REF 4346906), sealed with Optical Adhesive Covers (Applied Biosystems – REF 4360954). The reaction has been performed using QuantStudio 7 Flex instrument (Applied Biosystems) and software QuantStudio 6 and 7 Flex (Applied Biosystems). Expression level was calculated according to the 2^–ΔΔCT method (Livak and Schmittgen, 2001 (link)) by using GAPDH as a control gene. The data are presented as fold changes relative to the indicated reference sample.

Scerra G., De Pasquale V., Pavone L.M., Caporaso M.G., Mayer A., Renna M, & D'Agostino M. (2021). Early onset effects of single substrate accumulation recapitulate major features of LSD in patient-derived lysosomes. iScience, 24(7), 102707.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!