Dose–response curves for the induction of CYP1A1 mRNA expression by TCDD exposure were determined after 24 h of exposure using quantitative reverse transcription PCR (qRT-PCR). AHR mRNA to assess the level of overexpression, zeocin resistance gene (ZEO) expression to quantify transfection efficiency, as well as β-actin (ACTB) mRNA expression levels were determined in sample aliquots measured in parallel. All qRT-PCR data, including background AHR and ARNT mRNA levels measured in HeLa and HepG2 cells, were normalized for differences in cDNA input based on ACTB mRNA expression. Harvesting of cells from 96-well cell culture plates and qRT-PCR was carried out using the Ambion Power SYBR Green Cells-to-CT Kit (Thermofisher Scientific 4402954). Alternatively, for small-scale experiments and nontransfected HeLa and HepG2 cells, total RNA was isolated using TRIzol reagent (Invitrogen, Fisher Scientific), reverse transcribed into cDNA using the iScript cDNA Synthesis Kit, and quantitative PCR was carried out using IQ SYBR Green Supermix (both from Bio-Rad Laboratories B.V., Veenendaal, the Netherlands). All primers and annealing temperatures used are listed in supplementary material S8 , Supplementary Material online. Melt-curve analysis was performed to assure a single PCR product of the expected melting temperature. A Bio-Rad CFX Connect thermocycler was used throughout.
Ambion power sybr green cells to ct kit
Manufactured by Thermo Fisher Scientific
The Ambion Power SYBR Green Cells-to-CT Kit is a laboratory product designed for the direct quantification of gene expression from cultured cells. It provides a streamlined workflow for RNA extraction, reverse transcription, and real-time PCR analysis using SYBR Green detection.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Cfx connect thermocycler, by Bio-Rad (1 mentions)
Iq sybr green supermix, by Bio-Rad (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
7500 fast real time pcr thermocycler, by Thermo Fisher Scientific (1 mentions)
4 protocols using ambion power sybr green cells to ct kit
1
Quantifying CYP1A1 Induction Dynamics
2
Reverse Transcription and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RNA reverse transcription, the Ambion Power SYBR Green Cells-to-CT Kit (ThermoFisher, 4402954) was used according to the manufacturer’s instructions. The resulting complementary DNA was analysed using SYBR Green technology in the Applied Biosystems StepOnePlus Real-Time PCR System with StepOne Software using primers for CDKN1A and GAPDH listed in Supplementary Table 1 . After normalisation to GAPDH, gene expression was calculated relative to untreated control cells, as 2−ΔΔCT.
3
Quantitative PCR Analysis of Stem Cell Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction, reverse transcription and qPCR reaction were implemented by using the Ambion® Power SYBR® Green Cells‐to‐CT™ kit following manufacturer's instructions (Thermo) in a 7500 FAST Real‐Time PCR thermocycler with v2.0.5 software (Applied Biosystems). Calculation of mRNA fold change was analysed by using a 2(ΔΔCt) method in relation to the YAP, P4HA2 or GAPDH reference genes.
YAP1 sense: 5′‐TAGCCCTGCGTAGCCAGTTA‐3′, antisense: 5′‐TCATGCTTAGTCCACTGTCTGT‐3′;
GAPDH sense: 5′‐TGCACCACCAACTGCTTAGC‐3′, antisense: 5′‐GGCATGGACTGTGGTCATGAG‐3′;
P4HA2 sense: 5′‐GCCTGCGCTGGAGGACCTTG‐3′, antisense: 5′‐TGTGCCTGGGTCCAGCCTGT‐3′;
OCT4 sense: 5′‐TCAGGTTGGACTGGGCCTAGT‐3′, antisense: 5′‐GGAGGTTCCCTCTGAGTTGCTT‐3′;
SOX2 sense: 5′‐ GAGGGCTGGACTGCGAACT‐3′, antisense: 5′‐ TTTGCACCCCTCCCAATTC‐ 3′;
NANOG sense: 5‐GAAATCCCTTCCCTCGCCATC‐3′and antisense: 5′‐CTCAGTAGCAGACCCTTGTAAGC‐3′.
4
Measurement of Gaussia Luciferase Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
104 HeLa or 3T3 cells, or 2.5 × 104 JAWS II cells were seeded in 96-well plates as described above. For all experiments the passage number of studied cells was between 5 and 25. Cells in each well were transfected for 5 h using a mixture of 0.3 μl Lipofectamine MessengerMAX Transfection Reagent and 25 ng mRNA encoding Gaussia luciferase in 10 μl of Opti-MEM. RNA extraction and subsequential RT-qPCR analysis of chosen gene expression level was performed according to manufacturer's instruction (Ambion Power SYBR Green Cells-to-CT Kit (ThermoFisher Scientifics)). The GAPDH gene was used for normalization of relative expression values. All reactions were run in three independent replicates. The data sets in each independent replicate were normalized to unpurified 5′-triphosphorylated RNA (pppG-RNA); then, the average values were normalized to mock samples (set to 1) to give the final reported fold change values. Sequences of all used primers are shown in Supplementary Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!