Pmdg 2

The coding regions of mouse Aid (NM_009645.2, NCBI) and mouse Apobec1 (NM_001134391, NCBI) were cloned from mouse ES cells by RT-PCR. The PCR products were sequenced and subcloned into pENTR-D-TOPO (Invitrogen) and recombined with pMXs-gw [1] (link) using LR recombinase according to manufacturer’s instructions (Invitrogen). Mouse dominant-negative Apobec1 (H61K/C93S/C96S) [20] (link) was generated by PCR-based site-directed mutagenesis. To generate lentivirus vectors encoding doxycycline-inducible reprogramming factors, TRE, the Gateway cassette (Invitrogen) and rtTA2s-M2 (Clontech) were introduced into a pLKO.1 backbone (#10878, Addgene). Then coding sequences of Oct3/4, Sox2, Klf4 and c-Myc were inserted by the LR reaction to make pLV-TRE-rtTA2s-M2-Oct3/4, -Sox2, -Klf4 and -c-Myc. psPAX2 (#12260) and pMDG.2 (#12259) were obtained from Addgene. The primers used for the construction of plasmids are listed in Table S7.

Stable HUVEC control or overexpressing the full length JAG1 or DLL4, were generated after co-transfection of 30 μg of empty vector-containing pLenti6.2-V5 plasmid or full length JAG1 cDNA-containing pLenti6.2-V5 plasmid or full length DLL4 cDNA-containing pLenti6.2-V5 plasmid with 15 μg pPAX2 and 5μg of pMDG.2 (Addgene) into HEK293t packaging cell line using the CaCl₂ method. The viral supernatant was recovered and the transduced cells were generated by infection with 5 MOI (multiplicity of infectious units) of lentiviral particles. On the next day, cells were replaced with fresh medium, and a day later, cells were selected with 5 μg/mL of Blasticidin for 1 week. JAG1 and DLL4 expression was confirmed by Western blot and qPCR.

The lentiviral backbones lentiCRISPR v2 (#52961), lentiCRISPR v2-Blast (#83480) and plko.1 neo (13425) as well as helper plasmids pMDG.2 (#12259) and psPAX (#12260) were purchased from Addgene. MMP14 pHluorin plasmid was kindly provided by Kay Oliver Schink, Harald Stenmark and Philippe Chavrier. The BacMam mCherry-zyxin viral vector was used for transient zyxin expression [24 (link)]. CLCB QQN RFP vector was provided by P. McPherson. The Gateway Destination vector pDest RFP-C was used to clone CLCA and CLCB at the C-terminal end of RFP as well as the cDNA of human CLCA and CLCB (pENTR CLCA and pENTR CLCB) were obtained from the Vector and Clone Repository and repository genome wide cDNA library Gateway Full ORF Clones distributed by the GPCF available at the DKFZ. The following target gRNA sequences were used for genome editing: For single KO clones: CLCA−− (5’GCCTGGACGGCGGCGCCCCC3`) and CLCB−/− (5’AGAGAACGACGAGGGCTTCG3´). For double KO clones: CLCA−/− (5´GACGCGCCCGCACTCTCACC 3)´ and CLCB−/− (5´AGAGAACGACGAGGGCTTCG 3´). Following target sequence was used for shRNA mediated protein knock-down: MMP14 (5’CATTGCATCTTCCCTAGATAG 3´).

A MYC cDNA in a pDONR221 vector was provided by Alejandro Sweet-Cordero (University of California San Francisco, USA) and cloned into a pLenti6/V5-DEST using the Gateway system (Thermofisher). Lentivirus were produced by transfection of 2 μg of lentiviral plasmid, 0.5 μg of packaging plasmid (psPAX2 – Addgene; #12260) and 0.7 μg of envelope plasmid (pMD.G2 – Addgene; #12259) into HEK293T cells using X-tremeGENE HP DNA Transfection Reagent (Roche). Forty-eight hours later, supernatant was harvested, filtered and applied directly to cells for infection at a MOI lower than 1.