Mo bio power fecal dna isolation kit
The Mo Bio Power Fecal DNA Isolation kit is a laboratory equipment product designed for the extraction and purification of DNA from fecal samples. The kit provides a standardized procedure to isolate high-quality DNA from complex fecal matrices.
Lab products found in correlation
25 protocols using mo bio power fecal dna isolation kit
Porcine Fecal Microbiome Extraction
Fecal Microbiome DNA Extraction and 16S Sequencing
contamination, DNA was then extracted from the inner part of the fecal samples
(0.25 g) using the MO BIO PowerFecal™ DNA Isolation Kit (MO BIO
Laboratories, Carlsbad, CA, USA) according to the manufacturer’s
instructions and the DNA concentration was measured by using Nanodrop (Thermo
Scientific). DNA pyrosequencing was performed at the Beijing Genomics Institute
(BGI Shenzhen, China) via 454 Life Sciences/Roche GS FLX Titanium platform.
Briefly, DNA was amplified by using the V1–V3 hypervariable regions of
the bacterial 16S rRNA gene bar-coded primers (forward: CCGTCAATTCMTTTGAGTTT,
reverse: ACTCCTACGGGAGGCAGCAG). The PCR reaction (50 μl)
contained 50 ng DNA, 41 μl molecular biology grade
water, 5 μl 10 x FastStart High Fidelity Reaction Buffer
containing 18 mM MgCl2, 1 μl dNTPs
(10 mM each), 1 μl Fusion Primer A (10 mM),
1 μl Fusion Primer B (10 mM), and 1 μl
FastStart High Fidelity Enzyme Blend (5 U/ml). PCR cycles included
95 oC for 2 min; 30 cycles of
95 oC for 20 s, 50 oC
for 30 s, and 72 oC for 5 min; and a
final extension at 72 oC for 10 min.
Metagenomic Analysis of Rat Gut Microbiome
16S rDNA V4 Amplicon Sequencing
Shotgun Sequencing of Microbial DNA
Fecal Metagenomic DNA Extraction and Sequencing
The metagenome dataset used in this study was deposited into the National Centre for Biotechnology Information's Sequence Read Archive (SRA;
Fecal Microbiome Profiling Using 16S rRNA
Profiling Gut Microbiome via 16S rDNA
Bacterial DNA Extraction and 16S Amplicon Sequencing
Fecal microbiome 16S rRNA sequencing
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!