The largest database of trusted experimental protocols

Pgl3 promoter luciferase reporter plasmid

Manufactured by Promega

The PGL3 promoter luciferase reporter plasmid is a genetic tool that contains a promoter sequence fused to a luciferase reporter gene. This plasmid is designed to measure promoter activity in cells through the quantification of luciferase enzyme activity.

Automatically generated - may contain errors

2 protocols using pgl3 promoter luciferase reporter plasmid

1

Androgen Receptor Binding Site Reporter

Check if the same lab product or an alternative is used in the 5 most similar protocols
Firefly luciferase reporter vectors harboring the AR binding site of the MLPH gene, with the major T allele of SNP rs11891426:T>G, were constructed according to the procedures previously described (Bu, et al., 2013a (link)). Briefly, the MLPH ARBS was PCR amplified using primers F: 5′-TATCCAACACACGGGCTGAT -3′ and R: 5′-AGCTTTGGGGATTTCATTTCA -3′, purified and first ligated to the PCR fragment cloning vector PSC-B (Agilent Technologies, Santa Clara, CA) and then inserted into the KpnI/SacI sites of the PGL3 promoter luciferase reporter plasmid (Promega, Madison, WI). The minor G allele counterpart of the reporter vector or mutations of the two putative androgen-responsive elements (AREs) were generated using the QuikChange II site-directed (Agilent) or the Q5 site-directed mutagenesis (NEB, Ipswich, MA) kits. Primers used for mutagenesis were 5′-CAGCTCCCTGCTGCCAGCCTGGGG′ for G allele alteration, 5′-GCTTCCAGCCTGGGGTGCGTTCTGCACGCCTCCCTGAAATG for mutation of AR binding motif 3 and 5′-GCCAGCCCACAGCGTTCTGCACGCAGCCTGGGGTGGGAC for mutation of AR binding motif 2.
+ Open protocol
+ Expand
2

Luciferase Reporter Assay for MLPH Gene Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Firefly luciferase reporter vectors harboring the ARBS of the MLPH gene, with the major T allele of SNP rs11891426:T>G, were constructed according to the procedures previously described [Bu et al., 2013]. Briefly, the MLPH ARBS was PCR amplified using primers F: 5′‐ TATCCAACACACGGGCTGAT ‐3′ and R: 5′‐ AGCTTTGGGGATTTCATTTCA ‐3′, purified and first ligated to the PCR fragment cloning vector PSC‐B (Agilent Technologies, Santa Clara, CA), and then inserted into the KpnI/SacI sites of the PGL3 promoter luciferase reporter plasmid (Promega, Madison, WI). The minor G allele counterpart of the reporter vector or mutations of the two putative androgen‐responsive elements (AREs) were generated using the QuikChange II site‐directed (Agilent) or the Q5 site‐directed mutagenesis (NEB, Ipswich, MA) kits. Primers used for mutagenesis were 5′‐CAGCTCCCTGCTGCCAGCCTGGGG for G allele alteration, 5‐GCTTCCAGCCTGGGGTGCGTTCTGCACGCCTCCCTGAAATG for mutation of AR binding motif 3 and 5′‐GCCAGCCCACAGCGTTCTGCACGCAGCCTGGGGTGGGAC for mutation of AR‐binding motif 2.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!