To construct the RFP fused CoRAS2 vector, we amplified the RFP gene and linearized pBIG4MRBrev–CoRAS2 vector by PCR using the primer pairs RFPF1–glyRFPR1 and CoRAS2pBIF1–R1, respectively. Next, the pBIG4MRBrev–RFP–CoRAS2 vector was constructed with the amplified product using the GeneART seamless cloning and assembly kit. To construct the RFP–fused CoRAS2Q65L vector, we amplified the RFP gene and linearized pBIG4MRBrev–CoRAS2Q65L vector using the primer pairs RFPF1–glyRFPR1 and CoRAS2pBIF1–R1, respectively. Next, the pBIG4MRBrev–RFP–CoRAS2Q65L vector was constructed with the amplified product using the GeneART seamless cloning and assembly kit.
Seamless cloning and assembly kit
Manufactured by Thermo Fisher Scientific
The Seamless Cloning and Assembly Kit is a laboratory tool designed for the efficient and precise insertion of DNA fragments into plasmid vectors. The kit utilizes a proprietary technology that enables the seamless joining of multiple DNA sequences without the need for restriction enzyme digestion or ligation steps.
Automatically generated - may contain errors
Lab products found in correlation
25 protocols using seamless cloning and assembly kit
1
Construction of RFP-fused CoRAS2 Vectors
2
Construction of VENUS-CoIRA1 and VENUS-CoRAS2 Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To construct the VENUS-N fused CoIRA1 vector, we amplified the VENUS–N fragment, the hygromycin-resistance gene, and the linearized pBIG4MRBrev–CoIRA1 vector by PCR using the primer pairs glyGFPF1–αGFPR1, VENUShphF1–VENUSR1, and pBICoIRA1–VENUSF1–CoIRApBIcomR1–GFP respectively. Next, the pBIG4MRBrev–CoIRA1–nVENUS–hph vector was constructed with the amplified product using the GeneART seamless cloning and assembly kit. To construct the VENUS–C fused CoRAS2 vector, we amplified the VENUS–C fragment and linearized pBIG4MRBrev–CoRAS2 vector by PCR using the primer pair BGFPF2–glyGFPR1 and CoRAS2PBIcompF3–c–CoRAS2PBIcompR3, respectively. Next, the pBIG4MRBrev–cVENUS–CoRAS2 vector was constructed with the amplified product using the GeneART seamless cloning and assembly kit.
3
Constructing VENUS Fusion Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To construct the pBITEF–VENUS vector, we amplified a 0.9-kb fragment containing the TEF promoter and the upstream region of the GFP gene, a 0.6-kb fragment containing the downstream region of the GFP gene, and the linearized pBIG4MRBrev vector by PCR using the primer pairs TEFF1–VENUSR1, VENUSF1–glyGFPR1, and pBIG4VENUSF1–R1, respectively. Next, the pBIG4MRBrev–TEF–VENUS vector was constructed with the amplified product using the GeneART seamless cloning and assembly kit. To construct the CoIRA1–VENUS vector, we amplified the VENUS gene, the hygromycin-resistance gene, and the linearized pBIG4MRBrev–CoIRA1 vector by PCR using the primer pairs glyGFPF1–GFPR1, VENUShphF1–VENUSR1, and pBICoIRA1–VENUSF1–CoIRApBIcomR1–GFP, respectively. Next, the pBIG4MRBrev–CoIRA1–VENUS–hph vector was constructed with the amplified product using the GeneART seamless cloning and assembly kit.
4
Agroinoculation of PlAMV and PVX Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Leader-sequence variants of PlAMV-sgRNA1 and PVX-sgRNA1 for agroinoculation (PlAMV-sgRNA1-5U1nt, -3nt, -5nt, -7nt, and -10nt;
PVX-sgRNA1-1nt, -4nt, -7nt, and -10nt). The sgRNA1 sequences of pPlAMV and pPVX were amplified via PCR using the primer sets shown in Supplementary Table 4.
Plasmid fragments were obtained from pPlAMV using the GRF/35SR primer set. The fragments were ligated using a GeneArt Seamless Cloning and Assembly Kit.
(xi) Leader-sequence variants of PVX-GFP for agroinoculation (PVX-GFP-5U4nt
and -10nt). The sgRNA1 sequence was amplified from pPVX-GFP via PCR using the primer sets shown in Supplementary Table 4. The plasmid fragments were obtained from pPVX-GFP using the PVXTGB1F/35SR primer set. The fragments were ligated using a GeneArt Seamless Cloning and Assembly Kit.
PVX-sgRNA1-1nt, -4nt, -7nt, and -10nt). The sgRNA1 sequences of pPlAMV and pPVX were amplified via PCR using the primer sets shown in Supplementary Table 4.
Plasmid fragments were obtained from pPlAMV using the GRF/35SR primer set. The fragments were ligated using a GeneArt Seamless Cloning and Assembly Kit.
(xi) Leader-sequence variants of PVX-GFP for agroinoculation (PVX-GFP-5U4nt
and -10nt). The sgRNA1 sequence was amplified from pPVX-GFP via PCR using the primer sets shown in Supplementary Table 4. The plasmid fragments were obtained from pPVX-GFP using the PVXTGB1F/35SR primer set. The fragments were ligated using a GeneArt Seamless Cloning and Assembly Kit.
5
Constructing pME4576 and pME4579 Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For production of pME4576, sgfp was amplified from pME4292 with primers kt229/SR18 and, together with the sclB ORF and its 5’ flanking region (4.4 kb, primers kt208b/228), the sclB 3’ region (primers kt211/224) and the natRM cassette was cloned into pBluescript SK(+), employing the Seamless Cloning and Assembly Kit (Invitrogen). Subsequently, the sclB::sgfp construct was excised from pME4576 with MssI and transformed into AGB1007 resulting in AGB1009. Successful transformation at the correct locus was verified by Southern hybridization.
For production of pME4579, the 5’ flanking region of sclB (primers kt209/307), sgfp (primers SR120/121), sclB ORF (primers kt230/231), the phleoRM cassette and the sclB 3’ flanking region (primers kt211/225) were cloned into pBluescript SK(+), employing the Seamless Cloning and Assembly Kit (Invitrogen). Subsequently, the sgfp::sclB construct was excised from pME4579 with MssI and transformed into AGB1007, obtaining AGB1010.
The plasmid pME3173 was transformed into AGB1009 and AGB1010, resulting in AGB1012 and AGB1013, respectively, to facilitate the visualization of nuclei. pME3173 was transformed into AGB551 resulting in AGB1014 to obtain a suitable negative control for microscopy.
For production of pME4579, the 5’ flanking region of sclB (primers kt209/307), sgfp (primers SR120/121), sclB ORF (primers kt230/231), the phleoRM cassette and the sclB 3’ flanking region (primers kt211/225) were cloned into pBluescript SK(+), employing the Seamless Cloning and Assembly Kit (Invitrogen). Subsequently, the sgfp::sclB construct was excised from pME4579 with MssI and transformed into AGB1007, obtaining AGB1010.
The plasmid pME3173 was transformed into AGB1009 and AGB1010, resulting in AGB1012 and AGB1013, respectively, to facilitate the visualization of nuclei. pME3173 was transformed into AGB551 resulting in AGB1014 to obtain a suitable negative control for microscopy.
6
Expression and Purification of LGG Msp Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Msp genes were amplified from LGG genomic DNA by primers LGG-Msp1-OE-F/R, LGG-Msp2-OE-F/R, LGG-Msp3-OE-F/R. For Msp1 expression, msp1 gene was cloned into the pET28b-MBP-TEV vector (Currinn et al., 2016 (link)). For Msp2 and Msp3 expression, msp2 and msp3 genes were cloned into the pET28b vector. msp genes were cloned into a corresponding vector using the GeneArt Seamless Cloning and Assembly Kit following the manufacturer's instruction. Positive colonies were confirmed by colony PCR and Sanger sequencing. Constructed expression vectors were then transformed into BL21 (DE3). Msps were induced by adding 0.1 mM IPTG when an OD600 = 0.8 was achieved and the bacteria were grown overnight at 18°C. Bacteria were collected by centrifuge at 5,000× g for 10 min and lysed by sonication. Msps were purified using Ni-NTA Agarose according to the manufacturer's instructions and stored in storage buffer (50 mM Tris-HCl, 150 mM NaCl, 1 mM DTT, 10% glycerol, pH 7.6). For Msp1-MBP fusion protein, the MBP tag was removed by TEV protease following the manufacturer's instruction. Purified proteins were confirmed by SDS-PAGE.
7
Functional Analysis of Mutant Tas2r138
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Tas2r138 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (GenBank: BC128016.1). The ORF sequences were cloned into the vector pcDNA3.1+/C-(K)DYK (clone ID: OMu58142, Genescript). The R64A mutant plasmid was amplified by Thermo Fisher Scientific Phusion high-fidelity PCR kit and ligated by GeneArt seamless cloning and assembly kit, then transformed to DH5α for plasmid application. Then the nonmutant and mutant plasmids were transfected to neutrophils. Twenty-four hours post transfection, cell lysate was qualified by BCA and co-cultured with AHL-12 for 2 h. TAS2R138 protein was detected by western blotting. CGG (R) mutant to GCG (A). Primers for mutation: mut-t2r-f, AGCATCACTGCGCTTTTCCTGCAGGGCCCTGC and mut-t2r-r, CAGGAAAAGCGCAGTGAT GCTGAGACACAGCAG.
8
Immortalized Cell Line for DSCR4 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell culture The human papillomavirus 16 E6/ E7-transformed cell line HS-27A, an immortalized noncancerous cell type with epithelial morphology, was purchased from ATCC (CRL-2496) and cultured in RPMI-1640 medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS) (Invitrogen) according to ATCC protocols.
Plasmid DNA vector and control vector construction The PTCN-DSCR4 expression vector (BC096162), which contains the full-length cDNA sequence of DSCR4 including upstream and downstream untranslated regions (UTRs), was purchased from transOMIC technologies (Supplementary Fig. S1A). No marker was added to DSCR4 cDNA, to ensure that the function of the extra copy of DSCR4 was not affected. Cytomegalovirusderived promoter and enhancer sequences placed before DSCR4 cDNA in the vector ensure proper expression in eukaryotic cells. For production of a control plasmid (PTCN-control), we removed the DSCR4 cDNA sequence along with UTR elements from PTCN-DSCR4 using a GeneArt Seamless Cloning and Assembly kit (Supplementary Fig. S1B). With DSCR4 cDNA being the only difference between PTCN-DSCR4 and PTCN-control, we sought to minimize the confounding elements in our differential gene expression analysis.
Plasmid DNA vector and control vector construction The PTCN-DSCR4 expression vector (BC096162), which contains the full-length cDNA sequence of DSCR4 including upstream and downstream untranslated regions (UTRs), was purchased from transOMIC technologies (Supplementary Fig. S1A). No marker was added to DSCR4 cDNA, to ensure that the function of the extra copy of DSCR4 was not affected. Cytomegalovirusderived promoter and enhancer sequences placed before DSCR4 cDNA in the vector ensure proper expression in eukaryotic cells. For production of a control plasmid (PTCN-control), we removed the DSCR4 cDNA sequence along with UTR elements from PTCN-DSCR4 using a GeneArt Seamless Cloning and Assembly kit (Supplementary Fig. S1B). With DSCR4 cDNA being the only difference between PTCN-DSCR4 and PTCN-control, we sought to minimize the confounding elements in our differential gene expression analysis.
9
Yeast Two-Hybrid Assay for Protein Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Matchmaker GAL4 Two-Hybrid System 3 kit (Clontech) was used for Y2H assays as described previously (Yamaji et al., 2006) . Briefly, lithium acetate-treated yeast cells (strain AH109) were cotransformed with appropriate pairs of pGADT7 and pGBKT7 vectors. The cotransformants were plated on synthetically defined (SD) leucine/tryptophan/histidine-lacking medium containing 5-mM 3-amino-1,2,4-triazole (Sigma-Aldrich, St. Louis, MO, USA) (SD/-LWH + 3AT). The plates were incubated for 4 days at 30°C. Some of constructions used in the experiments were created in previous reports (Maejima et al., 2014; Kitazawa et al., 2017; Iwabuchi et al., 2019 Iwabuchi et al., , 2020)) . For further constructions, RAD23A and RAD23B were amplified by PCR from Arabidopsis (col-0) cDNA using the primers listed in Supplemental Table S1 and cloned into pGADT7 digested with NdeI and EcoRI-HF (NEB), using the GeneArt Seamless Cloning and Assembly Kit. In the same way, domains of the Arabidopsis MTF and RAD23 used in the experiments were also amplified from Col-0 using the appropriate pair of primers (Supplemental Table S1) and cloned into NdeI/EcoRI-HF-digested pGADT7. OsRAD23 or its UBA2 domain was amplified from rice (cv. Koshihikari) cDNA and cloned in the same way. SEP3 94-145 or SEP3 146-
10
Generation of Δflbε Deletion Mutant
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For production of pME4597, 1.3 kb of the flbE 5’ region (primers kt527/528), 1.1 kb of the respective 3’ region (primers kt529/530) and the phleoRM cassette were cloned into pBluescript SK(+), employing the Seamless Cloning and Assembly Kit (Invitrogen). The ΔflbE cassette was excised from pME4597 with MssI and integrated into AGB551, AGB1007 and AGB1008, resulting in AGB1047, AGB1048 and AGB1049.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!