The shRUNX1 and LV-RUNX1 lentiviruses were obtained from Genechem (Shanghai, China). The siSUV39H1 siRNA was obtained from Genepharma (Shanghai, China). The LV-SUV39H1 plasmid was obtained from (Vigenebio, Jinan, China). The shRUNX1 target sequence, siSMAD3 sequence and siSUV39H1 sequence are provided in Table S6 . Flag-RUNX1RHD-del (del 135–167) and Flag-SMAD3MH1-del(del 57–94) were created by polymerase chain reaction with the insertion of a BglII restriction site to join the fragments. The mutated sequence was inserted into the PCMV-N-FLAG series vectors, which was made by IBSBIO(Shanghai, China), based on the website (http://asia.ensembl.org/ ). Mutated or wild-type promoters containing the putative target regions of BCL3, MGP and POSTN were synthesized and cloned into pGL4.10 [luc2] (Promega, Madison, WI, USA) vector sites and the pGL4.70 [hRluc] (Promega Madison, WI, USA) was used as a promoter-less control vector. The open reading frames (ORFs) of RUNX1, SMAD3, and SUV39H1 were cloned with a C-terminal Flag into pENTER (Vigenebio, Jinan, China). The siRNAs and plasmids were transfected into cells using Lipofectamine 3000 (Invitrogen, USA) according to the manufacturer’s protocol.
Pgl4.70 hrluc
Manufactured by Promega
Sourced in United States
The PGL4.70 [hRluc] is a laboratory instrument designed to measure the activity of the humanized Renilla luciferase (hRluc) reporter gene. This product provides a reliable and sensitive tool for researchers to quantify gene expression in various experimental systems.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Penter, by Charles River Laboratories (1 mentions)
Pgl4.10 luc2, by Promega (1 mentions)
Anti β actin, by Merck Group (1 mentions)
Anti tubulin, by Merck Group (1 mentions)
Doxycycline, by Merck Group (1 mentions)
Anti c myc, by Merck Group (1 mentions)
Hygromycin, by Roche (1 mentions)
Mg132, by R&D Systems (1 mentions)
Qiaamp dna kit, by Qiagen (1 mentions)
Nick translation kit, by Abbott (1 mentions)
Pgl4.75 vector, by Promega (1 mentions)
Plko 1 blasticidin, by Addgene (1 mentions)
Pbabe neomycin, by Addgene (1 mentions)
On targetplus non targeting control pool, by Horizon Discovery (1 mentions)
Pbabe puro, by Addgene (1 mentions)
5 protocols using pgl4.70 hrluc
1
Lentiviral Transduction and Plasmid Transfection
2
Plasmid Constructs for NF-κB Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following expression plasmids were used in this study: pYNC989 (vFLIP-myc), pNF-kB-Luc (Stratagene), pGL4.70[hRluc] (Promega) and pcDNA3.1. pCMV-myc-RAUL-WT and the pCMV-myc-RAUL dominant negative mutant (C1051A) were provided by Cecile Pickart [17] (link). pSEW R01 (WT RTA), pSEW R03, pSEW R04, pSEW R06, pSEW R11 and RTA H145L have been described previously [13] (link), [18] (link). V5 tagged RTA 11–149 was cloned into pcDNA3.1 using the following primers: F- 5′-ATCGGAATTCGTTATGGTTCGGCGGTCCTGTGTGGAAAG and R-5′-TATATCTAGATTTTCACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAG GCTTACCCAGGCATTTGGCCTTCATTTCAG . The following reagents were used in this study: MG132 (Boston Biochem), doxycycline (Sigma), hygromycin (Roche), and antibodies anti-cmyc (Millipore), anti-tubulin (Sigma), anti-β-actin (Sigma), rabbit anti-RTA and rabbit anti-RAUL (24, 25).)
3
Genomic DNA Isolation and Fluorescent Probes
4
Dual Luciferase Assay for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HCT-116 cells were transfected with NC siRNA or siFAM188B with pGL2-p21-luc (Addgene, Cambridge, MA, USA) and pGL4.70hRluc (Promega, Madison, WI, USA) plasmids. After 24 and 48 h, cells were collected, and dual luciferase assays were performed according to the manufacturer’s protocol (Promega) and measured using a Victor3 (link) reader (Perkin Elmer).
5
Plasmid and shRNA Cloning for NF-κB Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following plasmids were used: pFB NEO LACZ, DAB2IP, R289L, and S604A, which were previously described (16 (link)). LACZ, DAB2IP, R289L, and S604A were also cloned into the pHAGE-C-Flag-HA lentiviral expression vector (Dr. J. Wade Harper, Harvard Medical School, Boston, MA).
For knockdown experiments, 3′-UTR DAB2IP short hairpin RNA (shRNA; 5′- GTAATGTAACTATCTCACCTA −3′) and a control shRNA (5′-CCTAAGGTTAAGTCGCCCTCG-3′) were used as previously described (16 (link)). 3′-UTR shDAB2IP and control shRNA were also cloned into PLKO.1 blasticidin (Addgene, catalog no. 26655). siControl and siDAB2IP were purchased from Dharmacon (ON-TARGETplus Non-targeting Control Pool, catalog no. D-001810–10, and SMARTpool HUMAN siGENOME DAB2IP, catalog no. #L-008249–01: 5′-CGCAGUUGUUAGAAGACGA-3′ / 5′-GGCUAAGGAGUAAGGACGA-3′ / 5′-GGACCAACAUGCAGCGCUU-3′ / 5′-GAUAGAUUUCACCCGGUUA-3′).
For the NF-κB assays, pNF-κB luciferase and pRL-TK (RRID:Addgene_11313), or pGL4.70 [hRluc] (Promega, catalog no. E6881) are the reporter plasmids used (17 (link)). pBABE puro (RRID:Addgene_21836; control), pBABE IκBα super repressor puro (RRID:Addgene_15291) or IκBα super repressor cloned into pBABE neomycin (RRID:Addgene_1767) were used as inhibitors of NF-κB signaling.
For knockdown experiments, 3′-UTR DAB2IP short hairpin RNA (shRNA; 5′- GTAATGTAACTATCTCACCTA −3′) and a control shRNA (5′-CCTAAGGTTAAGTCGCCCTCG-3′) were used as previously described (16 (link)). 3′-UTR shDAB2IP and control shRNA were also cloned into PLKO.1 blasticidin (Addgene, catalog no. 26655). siControl and siDAB2IP were purchased from Dharmacon (ON-TARGETplus Non-targeting Control Pool, catalog no. D-001810–10, and SMARTpool HUMAN siGENOME DAB2IP, catalog no. #L-008249–01: 5′-CGCAGUUGUUAGAAGACGA-3′ / 5′-GGCUAAGGAGUAAGGACGA-3′ / 5′-GGACCAACAUGCAGCGCUU-3′ / 5′-GAUAGAUUUCACCCGGUUA-3′).
For the NF-κB assays, pNF-κB luciferase and pRL-TK (RRID:Addgene_11313), or pGL4.70 [hRluc] (Promega, catalog no. E6881) are the reporter plasmids used (17 (link)). pBABE puro (RRID:Addgene_21836; control), pBABE IκBα super repressor puro (RRID:Addgene_15291) or IκBα super repressor cloned into pBABE neomycin (RRID:Addgene_1767) were used as inhibitors of NF-κB signaling.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!