Reverse transcription polymerase chain reaction rt pcr kit

Synthesis of cDNA from total RNA and subsequent PCR was performed with a Reverse Transcription Polymerase Chain Reaction (RT‐PCR) Kit (TaKaRa) as previously described 14. Real‐time PCR was performed with a SYBR Green Reaction Kit according to the manufacturer's instructions (Roche Diagnostics, GmbH, Mannheim, Germany) on a LightCycler (Roche Diagnostics).
The following primers were used for real‐time RT‐PCR: TMEM207, PPH12073A‐200 (Qiagen); GLUT‐1 forward 5′‐TGCTTGTGGATTGAGGGTAGGA‐3′; GLUT‐1 reverse 5′‐AAGTCTAAGCCGTTGCAGTGG‐3′; GAPDH forward 5′‐GAAATCCCATCACCATCTTCCAGG‐3′; GAPDH reverse 5′‐GAGCCCCAGCCTTCTCCATG‐3′. The samples were cultured in triplicate, and the expression of each target gene was analysed using the 2^(−ΔΔCT) method 24. The ΔCT values were normalized to GAPDH for each triplicate set in both the negative control (the siRNA‐treated group) and the three siTMEM207‐treated groups. Values for each of the three target genes were expressed as fold change relative to the ones of the control group (set to 1.0). Standard deviations were computed for the triplicate sets. In addition, Student's t‐tests were performed to determine significant differences among groups with P < 0.05 considered statistically significant.

Gene expression for the TLR pathway including TLR2, TLR4, MYD88, and NFκB; for the Nrf2 pathway, including Nrf2, HO-1, and NQO-1; and for apoptotic markers, including Bax and Bcl2 were quantified via real-time PCR (qPCR), consuming the primers’ sequences in compliance with the method described elsewhere [30 (link)]. Briefly, RNA was isolated and purified using the Trizol reagent kit (Invitrogen, Carlsbad, CA, USA), then reverse transcribed using the reverse transcription-polymerase chain reaction (RT-PCR) kit (TaKaRa, Kusatsu, Shiga, Japan), following the manufacturer’s procedures. qPCR was applied using SYBR ExScript RT-PCR kit, and quantification examinations were completed via Opticon-2 Real-time PCR reactor (MJ Research, Capital Court, Reno, NV, USA). qPCR results were obtained using Step PE Applied Biosystems (Waltham, MA, USA) software. Target gene expressions were evaluated and correlated to the β-actin as the reference gene, and the results are shown in figures as relative expressions. The primer sequences used in this study were mentioned in Table 1.

The Qiagen Viral RNA Extraction Kit (QIAGEN, Germany) was used to extract viral RNA. The extraction process was carried out according to the manufacturer’s instructions. A CFX 96 real-time fluorescence quantitative polymerase chain reaction system (BioRad, Hercules, CA, USA) was used to amplify the viral RNA and detect and analyze the fluorescence signals. In this study, EV universal primers were examined by using a Fluorescence Quantitative Polymerase Chain Reaction (qPCR) Kit (BioGerm, Shanghai, China). Those patients who were positive continued to be tested and classified as EV-A71, CV-A6, CV-A10, or CV-A16. The negative specimens continued to be detected by a Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Kit (TAKARA, Japan) and were then sequenced to determine their serotypes. When the Ct value was > 38 or if pathogens were not detected, the specimens were confirmed as negative. The specimens with an S-shaped amplification curve and a Ct value ≤ 35 were confirmed to be positive. If the amplification curve was S-shaped and if the Ct value was between 35 and 38, the experiment was repeated; then, if the amplification curve was still S-shaped and if the Ct value was between 35 and 38, it was judged as positive. Otherwise, it was negative.