For the PpV rescue construct, a 2679 bp EcoRI fragment from BAC clone 18C-18 (BACPAC Resources Center) was isolated and cloned into the pattB vector (Bischof et al. 2007 (link)). For GFP-PpV, the 5′ terminal 444 bp (a HindIII/EcoRI-BspM1 fragment) was replaced by a corresponding 1229 bp fragment with codon optimized GFP and a linker inserted at the start codon, which was synthesized by Eurofins Genomics and cloned into the pattB vector. CS2-tribbles plasmid template was linearized by XhoI and transcribed by SP6 Transcription Kit (Ambion) (Grosshans and Wieschaus 2000 (link)). dsRNAs were produced by T7 RNA polymerase (Ambion), NTPs, RNase inhibitor (Thermo Fisher) and Pyrophosphatase (Thermo Fisher), using CS2-tribbles as template and dsRNA primers BL10 (GTAATACGACTCACTATAGGGCGATCAGCGCACAGCCTAGTCA) and BL11 (GTAATACGACTCACTATAGGGCGATGGCCATAGATGGTGCTCC) (Farrell and O’Farrell 2013 (link)).
Sp6 transcription kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The SP6 transcription kit is a reagent system used to perform in vitro transcription reactions. It contains the necessary components, including the SP6 RNA polymerase enzyme, to synthesize RNA molecules from a DNA template.
Automatically generated - may contain errors
Lab products found in correlation
T7 mmessage mmachine, by Thermo Fisher Scientific (4 mentions)
Rnase inhibitor, by Thermo Fisher Scientific (2 mentions)
Quikchange 2 site directed mutagenesis kit, by Agilent Technologies (2 mentions)
Xbai, by New England Biolabs (2 mentions)
Nucleospin gel and pcr clean up kit, by Macherey-Nagel (2 mentions)
Pyrophosphatase, by Thermo Fisher Scientific (1 mentions)
T7 rna polymerase, by Thermo Fisher Scientific (1 mentions)
Mmessagemmachine t7, by Thermo Fisher Scientific (1 mentions)
Nanodrop spectrometry, by Thermo Fisher Scientific (1 mentions)
Pierce rna 3 end biotinylation kit, by Thermo Fisher Scientific (1 mentions)
Megascript t7, by Thermo Fisher Scientific (1 mentions)
10 protocols using sp6 transcription kit
1
Genetic manipulation of PpV in Drosophila
2
TALEN-mediated Zebrafish peak1 Gene Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TALEN plasmids targeting zebrafish peak1 gene were constructed from the stock cassette as previously published14 (link) and the targeting site was illustrated in Supplementary Fig S2b . TALEN mRNAs were synthesized with Sp6 transcription kit (Ambion) as described in online methods. TALEN mRNAs of the left arm (TALEN L) and the right arm (TALEN R) were mixed at a 1:1 ratio to a final concentration of 60 ng/μl each. A total of 1 nl of TALEN mRNAs was injected into the one-cell stage embryos. Genomic DNA was extracted from individual embryo or from the tail fin of adult zebrafish and was genotyped by PCR and MslI enzyme digestion, and confirmed by sequencing as previously described.14 (link)
3
Xenopus and Mouse Sel1L and Hrd1 Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Xenopus Sel1L gene was cloned into pCS108 with a 3 × HA (hemagglutinin) tag fused to the C terminus of Sel1L. The signal peptide of Xenopus Sel1L was cloned into pCS108, and the SEL1Lc term domain was fused to the C terminus of the signal peptide with the C terminus 3 × HA tag. Cloned plasmids underwent in vitro transcription using an SP6 transcription kit (AM1340, Invitrogen) for microinjection. The translation-blocking antisense morpholino was designed and synthesized by Gene Tools LLC (OR, USA).
The mouse Sel1LFull gene was cloned into pCS108 with a C terminus 3 × FLAG tag. The signal peptide of Xenopus Sel1L was cloned into pCS108, and the mouse SEL1Lc term was fused to the carboxyl terminus of the signal peptide with a C terminus 3 × FLAG and ER retention signal, KDEL. The mouse HRD1 gene was cloned into pCS108 with a C terminus 3 × HA tag.
The mouse Sel1LFull gene was cloned into pCS108 with a C terminus 3 × FLAG tag. The signal peptide of Xenopus Sel1L was cloned into pCS108, and the mouse SEL1Lc term was fused to the carboxyl terminus of the signal peptide with a C terminus 3 × FLAG and ER retention signal, KDEL. The mouse HRD1 gene was cloned into pCS108 with a C terminus 3 × HA tag.
4
DENV and ZIKV Reporter Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids for DENV or ZIKV vectors which encode GFP (pFK-DVs-G2A for DENVGFP), Renilla luciferase (pFK-DVs-R2A, serotype 2, strain 16681 for DENVR2A; pFL-ZIKV-R2A strain FSS13025 for ZIKVR2A) reporter genomes, wild-type (WT) DENV (pFK-DVs; 16681), subgenomic (sg) replication-deficient NS5 mutant (sg-DVs-R2A-GND), and WT (sg-DVs-R2A-WT) subgenomic replicon systems were all obtained from Ralf Bartenschlager and Pei-Yong Shi. Plasmids were linearized with XbaI (DENV) or ClaI (ZIKV) and purified, and 1 μg was in vitro transcribed using the mMESSAGE mMACHINE T7 or SP6 transcription kit (Invitrogen). The resulting RNA quality and concentration were assessed by migration on a 0.8% agarose gel and Nanodrop spectrometry (Thermo Scientific), respectively.
5
Generating CRISPR sgRNA Targeting TGFB1
6
Mutagenesis of Shaker and CiVSP Channels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mutations of Shaker or CiVSP DNA were made on the ShakerΔ6–46W434F background (Hoshi et al., 1990 (link); Perozo et al., 1993 (link)) or the CiVSP C363S background (Murata et al., 2005 (link)), respectively, using the QuikChange II site directed mutagenesis kit (Agilent, Santa Clara, CA) with primers purchased from Integrated DNA Technologies. Shaker DNA was linearized using NotI (New England Biolabs, Ipswich, MA) and CiVSP DNA was linearized using XbaI (New England Biolabs); both were cleaned up with a NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel, Bethlehem, PA). Shaker and CiVSP cRNAs were then synthesized from linearized DNA using the mMESSAGE mMACHINE T7 or SP6 transcription kit, respectively (Life Technologies, Carlsbad, CA).
7
Mutagenesis of Shaker and CiVSP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mutations of Shaker or CiVSP DNA were made on the Shaker 6-46 W434F background (Perozo et al., 1993) or the CiVSP C363S background (Murata et al., 2005) (link), respectively, using the QuikChange II site directed mutagenesis kit (Agilent, Santa Clara, CA) with primers purchased from Integrated DNA Technologies. Shaker DNA was linearized using NotI (New England Biolabs, Ipswich, MA) and CiVSP DNA was linearized using XbaI (New England Biolabs); both were cleaned up with a NucleoSpin
Gel and PCR Clean-up kit (Macherey-Nagel, Bethlehem, PA). Shaker and CiVSP cRNAs were then synthesized from linearized DNA using the mMESSAGE mMACHINE T7 or SP6 transcription kit, respectively (Life Technologies, Carlsbad, CA).
Gel and PCR Clean-up kit (Macherey-Nagel, Bethlehem, PA). Shaker and CiVSP cRNAs were then synthesized from linearized DNA using the mMESSAGE mMACHINE T7 or SP6 transcription kit, respectively (Life Technologies, Carlsbad, CA).
8
LINC01094 Transcript Interactome Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The LINC01094 in vitro transcription plasmid was purchased from Hanyin Biotechnology (Shanghai, China). The LINC01094 in vitro transcription plasmid was constructed in the pcDNA3.1 vector. The T7 and SP6 RNA polymerase promoter sequences were added to the start and the end of the LINC01094 sequence, respectively. In vitro transcription of LINC01094 and that of its antisense chain were performed using MEGAscript T7 and SP6 transcription kits (Thermo Fisher, Waltham, MA, USA), respectively. Thereafter, LINC01094 and its antisense chain were biotin labeled by pierce RNA3′ end biotinylation kit (Thermo Fisher, Waltham, MA, USA). Pierce magnetic RNA-protein pulldown kit was utilized to perform pulldown assay, and the RNA-protein complex was analyzed by using mass spectrum and western blot.
9
Cas9 mRNA Synthesis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pXT7-Cas9 [9 (link)] was a gift from China Zebrafish Resource Center, CZRC, Wuhan, China, and pCS2-nls-zCas9-nls [10 (link)] was obtained from Dr. Wenbiao Chen. They were linearized using XbaI and NotI, respectively, purified with the phenol-chloroform method, and used as templates to synthesize Cas9 mRNA with the mMESSAGE mMACHINE T7 or SP6 Transcription Kits (Thermo Fisher Scientific, Waltham, MA, USA). Synthesized mRNAs were treated with Tango DNase supplemented by the kit, purified using the phenol-chloroform method, dissolved in RNase-free water and stored at −80 °C for use.
10
In vitro Cas9 mRNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In vitro Cas9 mRNA synthesis pXT7-Cas9 (Chang et al., 2013 ) is a gift from China Zebrafish Resource Center, CZRC, Wuhan, China, and pCS2-nls-zCas9-nls (Jao et al., 2013) was obtained from Dr.
Wenbiao Chen. They were linearized respectively using XbaI and NotI, purified with phenol-chloroform method, and used as templates to synthesize Cas9 mRNA with the mMESSAGE mMACHINE T7 or SP6 Transcription Kits (Thermo Fisher Scientific).
Synthesized mRNAs were treated with the Tango DNase supplemented by the kit, purified by phenol-chloroform method, dissolved in RNase-free water, and stored at -80 o C for use
Wenbiao Chen. They were linearized respectively using XbaI and NotI, purified with phenol-chloroform method, and used as templates to synthesize Cas9 mRNA with the mMESSAGE mMACHINE T7 or SP6 Transcription Kits (Thermo Fisher Scientific).
Synthesized mRNAs were treated with the Tango DNase supplemented by the kit, purified by phenol-chloroform method, dissolved in RNase-free water, and stored at -80 o C for use
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!