Nzyol reagent

Total RNA from mouse and human cerebral cortex was extracted using NZYol Reagent (NZYTech, Lisboa, Portugal) according to the manufacturer´s protocol. RNA concentration was measured in a Nanodrop One Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). A total of 1 ug was used for fist-strand complementary DNA synthesis with iScript cDNA Synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA). Quantitative real-time PCR (qRT-PCR) was performed on a Roche LightCycler 480 II (Roche Diagnostics, Basel, Switzerland) instrument using NZYSupreme qPCR Green Master mix (NZYTech, Lisboa, Portugal) according to the manufacturer´s recommendations. Primer sequences are listed in Table 3. HPRT mouse and human were used as endogenous reference. For relative quantification the Ct value of each gene was normalized with its endogenous reference gene using the 2^−ΔCt formula. Then, gene expression change was compared to the control sample expression using the 2^−ΔCt formula (2^−ΔΔCt formula, Ct = threshold cycle).

The following small interfering RNAs (siRNA) were designed by Custom siRNA Design Service (Merck) to target both isoforms of bovine Dectin-1 and achieve the knockdown of this receptor: siRNA #1 sense AUG AAG AUG GAU AUA CUC A dTdT, antisense UGA GUA UAU CCA UCU UCA U dTdT; siRNA #2 sense UGA GGA UAG CUG UUA UCU A dTdT, antisense UAG AUA ACA GCU AUC CUC A dTdT; siRNA #3 sense GAG GAU AGC UGU UAU CUA U dTdT, antisense AUA GAU AAC AGC UAU CCU C dTdT (all from Sigma-Aldrich). Transfection procedure was performed for 4 h in serum-free X-VIVO™ 15 haematopoietic medium (Lonza, Basel, Switzerland) with ScreenFect^®siRNA transfection reagent, according to manufacturer’s instructions (ScreenFect GmbH, Eggenstein-Leopoldshafen, Germany), and 300 nM of siRNA duplexes or siRNA negative control (MISSION^® siRNA Universal Negative Control #1, Sigma-Aldrich). After transfection, cells were washed with non-supplemented RPMI-1640 medium and incubated for 24 h at 37°C and 5% CO2 with WGP^®-Soluble, WGP^®-Dispersible and Zymosan^® at 50 µg/mL in RPMI medium or with medium alone. Supernatants were collected to assess IL-8 production and cells were preserved in NZYol reagent (NZYTech, Lisboa, Portugal) to assess CLEC7A, TNF, IL1B, IL6, and IL10 mRNA expression.

Total RNA extraction of plant tissues was performed using NZYol Reagent (NZYTech, Portugal) as indicated in Galvez-Valdivieso et al. (2013) (link). RNA was treated with RNAse-free DNAseI (NEB, United States) and checked by PCR for the absence of contaminating genomic DNA. Single strand random-primed cDNA was synthesized using RevertAid Reverse Transcriptase (ThermoFisher Scientific, United States). Quantitative Reverse Transcription PCR (qRT-PCR) was performed as described previously (Diaz-Baena et al., 2020 (link)). Results were normalized to the geometric mean of actin-2 and ubiquitin gene, and relative expression was calculated from 2^-∆∆CT values (Livak and Schmittgen, 2001 (link)). Primer specificity was verified by RT-PCR, sequencing the amplicons and following their dissociation curves. The sequence of the primers is shown in Supplementary Table S1.

3T3-L1 mouse embryo fibroblasts (obtained from the American Type Culture Collection, Mansassas, VA) were cultured at 37 °C in a humidified atmosphere of 5% CO₂ in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% (v/v) heat-inactivated bovine serum (FBS) supplemented with penicillin (100 U/ml) and streptomycin (100 μg/ml). To recover the cells when confluent (80–70% cells density), they were digested with 0.05% Trypsin-EDTA for 3 min at 37 °C and isolated from the culture medium by centrifugation. Total RNA was isolated from 3T3-L1 cells using the NZYol reagent (NZYTech) and DirectZol (Zymo Research), according to the manufacturer’s instructions. RNA quantification and integrity was evaluated on a 2100 Bioanalyzer (Agilent Technologies).

RNA was isolated from the cultures using the Nzyol reagent (Nzytech, Lisbon, Portugal) according to the manufacturer’s instructions. The concentration of RNA was measured by Nanodrop (Thermo Scientific, Waltham, MA, USA). cDNA synthesis was reverse transcribed to cDNA using a kit (Thermo Scientific). 1 µg total RNA from the cells was used for cDNA synthesis. DNA digestion was performed with DNase I treatment (Promega, Madison, WI, USA) for 30 min at 37 °C and reverse-transcribed for 1 h at 37 °C using M-MLV reverse transcriptase (Invitrogen, Waltham, MA, USA), oligo-d(T) universal primer (5′-ACGCGTCGACCTCGAGATCGATG(T)13-3′) and RNaseOUT (Invitrogen). Quantitative real-time PCR (qPCR) assays were performed using the Bio-Rad CFX system (Bio-RAD, Hercules, FL, USA). Gene expression was normalized using β-actin as a housekeeping gene [65 (link)], and relative quantification was determined using the ∆∆Ct method [66 (link)]. The primers used in this study are listed in Table 1.

Total cellular RNA was isolated using NZyol Reagent (NZYTech). cDNA was prepared by reverse transcription (GoTaq 2-Step RT-qPCR System, Promega) and amplified by PCR using SYBR^® Green PCR Master Mix and ABI Prism 7900HT sequence detection system (Applied Biosystems), with the following primers: mTNF-α F: CCACCACGCTCTTCTGTCTAC; R: AGGGTCTGGGCCATAGAACT; mIL-10 F: ATCGATTTCTCCCCTGTGAA; R: TGTCAAATTCATTCATGGCCT; mIL-12p40 F: TGGTTGCCATCGTTTTCCTG; R: ACAGGTGAGGTTCACTGTTTCT; mMKP-1 F: CTACCAGTACAAGAGCATCCC; R: AACTCAAAGGCCTCGTCCAG; mRPL13A F: ATCCCTCCACCCTATGACAA; R: GCCCCAGGTAAGCAAACTT. The 2−ΔΔCt method was applied to analyze the relative changes in expression profiling and all quantifications were normalized to the housekeeping gene RPL13A.