The largest database of trusted experimental protocols

21 protocols using cell counting kit 8 cck 8

1

Cell Proliferation Assay Using CCK-8

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell viability was analyzed using a Cell Counting Kit-8(CCK-8) (Sangon Biotech, China). Briefly, at a seeding density of 20,000 cells/ml of medium, stably-transfected cells/well were seeded in 96-well plates. At the 0 h, 24 h, 48h and 72h time points, the cells were incubated with CCK-8 solution at 37°C for 2h, before subjecting them spectroscopic analysis. The optical density (OD) value was determined as 450 nm using a microplate reader (Infinite M200). The experiment was done in triplicate and the average of the OD450 values was used to calculate cell growth rate.
+ Open protocol
+ Expand
2

ACTA1 Overexpression Impacts RH30 Cell Viability

Check if the same lab product or an alternative is used in the 5 most similar protocols
RH30 cells stably transduced with ACTA1 (RH30/ ACTA1) or empty vector (RH30/ vector) were plated in triplicate in 96-well plate at 2 × 103 /well in 100 ul DMEM supplemented with 10% FBS and cultured under normal conditions with a 5% CO2 atmosphere at 37 ℃. At different time points (0 h, 12 h, 24 h, 36 h, 48 h and 72 h), cell viability was measured by the Cell Counting Kit-8 (CCK-8, Sangon Biotech, Shanghai, PRC). The optical density (OD) value of each well was determined at 450 nm by a microplate reader (SpectraMax M5, Molecular Devices).
+ Open protocol
+ Expand
3

Cytotoxicity Evaluation of GM and PU

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEI-OC1 cells were seeded in a 96-well plate (5,000 cells per well) and incubated overnight at 33°C in 10% CO2. The cells were treated with different concentrations of GM (0.1, 0.2, 0.5, 1.0 and 2.0 mM) and PU (5, 10, 20, 50, 100, 200 and 300 µg/ml) for 24 h. A total of 10 µl Cell Counting Kit-8 (CCK-8; Sangon Biotech Co., Ltd.) was added to the treated cells in each well and incubated at 37°C for 1 h. The absorbance at 450 nm was determined with an ELISA reader (Multiskan MK3). The cell viability was calculated as (%) (OD assay - OD blank) / (OD control - OD blank) ×100%.
+ Open protocol
+ Expand
4

Aβ25-35 Neurotoxicity Pathway Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
25–35 (#A4559), agomelatine (#A1362), luzindole (#L2407), the primary antibodies against phosphotau (Ser396) (#SAB4504557), tau (#SAB4501830), PTEN (#SAB1406331), GAPDH (#SAB2701826), goat antirab-bit IgG (#A3687), and antibody antimouse IgG (#M8770) were purchased from Sigma-Aldrich Co., St Louis, MO, USA. The primary antibodies against phospho-Akt (Ser473) (#4060) and Akt (#4691) were purchased from Cell Signaling Technology, Danvers, MA, USA. The primary antibodies against phospho-GSK3β (Ser9) (Ab131097) and GSK3β (Ab93926) were purchased from Abcam, Cambridge, UK. Cell counting kit-8 (CCK-8) (#E606335-0500) and ROS assay kit (#50101ES01) were obtained from Sango Biotech (Shanghai, China). Cell MDA assay kit (#A003-4) and LDH assay kit (#A020-2) were purchased from Nanjing Jiancheng Bioengineering Institute (China).
+ Open protocol
+ Expand
5

Evaluating Anticancer Compounds in Thyroid Papillary Carcinoma

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human thyroid papillary carcinoma cell Papillary cells of human thyroid carcinoma BCPAP cell lines (BCPAP) was purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences. Quercetin (CAS No. 117-39-5), luteolin (CAS No. 491-70-3), beta-sitosterol (β-sitosterol) (CAS No. 83-46-5), kaempferol (CAS No. 520-18-3) were purchased from Selleck China company respectively. One thousand six hundred-forty culture medium, dimethyl sulfoxide (DMSO), fetal bovine serum, penicillin streptomycin double antibody, 0.25% trypsin, cell counting kit 8 (CCK8), and DMSO purchased from Sangon Biotech (Shanghai) Co., Ltd. RIPA Lysis Buffer, rabbit derived vascular endothelial growth factor A (VEGFA) antibody, tumor protein p53 (TP53) antibody, transcription factor AP-1 (JUN) antibody, prostaglandin endoperoxidase 2 (PTGS2) antibody, interleukin 6 (IL6) antibody, IL-1B antibody, rabbit derived House keeping protein. (glyceraldehyde-3-phosphate dehydrogenase) antibody and goat anti-rabbit IgG were purchased from Beyotime Biotechnology Co., Ltd. and ThermoFisher Scientific Co., Ltd. respectively. The instrument includes BioRad full-automatic microplate reader, BioRad chemiluminescence gel imaging system, OLYMPUS IX51 inverted microscope, MCO-15AC SANYO CO2 constant temperature incubator, Eppendorf 5702R low-speed centrifuge.
+ Open protocol
+ Expand
6

Cell Proliferation Assay for 3D Spheroids

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell proliferation was measured using the Cell Counting Kit-8 (CCK-8, Sangon, Shanghai, China). SLF-3D and ULA-3D spheroids (which were dissociated into single cells with Accutase) were plated into a 96-well microplate with 10% FBS DMEM/F12 medium at a density of 1,000 cells per well. At 24, 48, 72, and 96 h, CCK-8 reagent (10 µl per well) was added to the cells and then incubated at 37°C for 2 h, and then the growth curves of cells were generated using absorbance values detected using a microplate spectrophotometer (Tecan, Switzerland) at 450 nm.
To count the cells, the living and dead cells of SLF-3D and ULA-3D spheroids (which were dissociated into single cells with Accutase) were counted using either the Countess® Automated Cell Counter (Invitrogen) or hemocytometer and using Trypan blue (Invitrogen) exclusion.
+ Open protocol
+ Expand
7

Lentiviral shRNA Knockdown of HK2

Check if the same lab product or an alternative is used in the 5 most similar protocols
shRNA targeting HK2 (shHK2) and a negative control shRNA (shNC) were synthesized by Hanbio Biotechnology (Shanghai, China). The sequence of HK2 shRNA (GATCCGCCACAACTGTGAGATTGGTCTCATTTTCAAGAGAAATGAGACCAATCTCACAGTTGTGGTTTTTTC) was inserted into BamHI and EcoRI sites of pHBLV-U6-Scramble-ZsGreen-Puro. Recombinant lentivirus was constructed by Hanbio Biotechnology (Shanghai, China). Mouse anti-human HK2 antibody was purchased from Abcam (UK). Cell counting kit-8 (cck-8) was purchased from Sangon Biotech (Shanghai, China). Annexin V-FITC/PI Apoptosis kit was purchased from Bestbio (Shanghai, China).
+ Open protocol
+ Expand
8

Cell Viability Determination by CCK-8 Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell viability was determined by a Cell Counting Kit-8 (CCK-8) (Sangon, Shanghai, China). In brief, 7 × 103 cells were cultured in each 96-well plate, and incubated for 24, 48, 72, or 96 h, respectively. Subsequently, 10% CCK-8 reagent was added to each well for an additional 1 h before the endpoint of incubation at 37 °C in dark. The absorbance was measured at 450 nm (A450) by a microplate reader (Thermo Fisher). Experiments were repeated at least three times in 6 replicate wells per sample.
+ Open protocol
+ Expand
9

Cell Viability Assay with CCK-8

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell Counting Kit-8 (CCK-8; Sangon) was used for the examination of cell viability of OC cells. At 0 h, 24 h, 48 h and 72 h after transfection, CCK-8 solution was pipetted to OC cells in the 96-well plates with 10 μL/well. Incubating for 2 h, the optical density (OD) value at 450 nm was detected with a microplate reader (Beyotime, Shanghai, China).
+ Open protocol
+ Expand
10

Quantifying Cell Viability with CCK-8

Check if the same lab product or an alternative is used in the 5 most similar protocols
The viability of hBMSCs and chondrocytes was determined using the Cell Counting Kit-8 (CCK-8, Sangon Biotech, Shanghai, China). Cells were seeded in 96-well plates in 5% CO2 at 37 °C; CCK-8 solution (10 μL) was added to each well and cultivated for 1 h. Next, a microplate reader (BioTek Instruments Inc.) was used to measure the absorbance at 450 nm.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!