Log In Sign up
The largest database of trusted experimental protocols

Mutagenesis kit

Manufactured by Agilent Technologies
Visit Supplier
Sourced in United States

The Mutagenesis kit is a laboratory tool designed to introduce targeted genetic modifications into DNA sequences. It provides the essential components and protocols for performing site-directed mutagenesis experiments.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamin 2000, by Thermo Fisher Scientific (3 mentions) Pmir report, by Thermo Fisher Scientific (2 mentions) Dual luciferase reporter assay system, by Promega (2 mentions) Discovery studio client 4, by Dassault Systèmes (1 mentions) Anti smad4 antibody, by Santa Cruz Biotechnology (1 mentions) Gateway lr clonase kit, by Thermo Fisher Scientific (1 mentions) Lenticrispr v2 plasmid, by Addgene (1 mentions) Quickchange 2 site directed mutagenesis kit, by Agilent Technologies (1 mentions) Pentr d topo vector, by Thermo Fisher Scientific (1 mentions) Pcbascei plasmid, by Addgene (1 mentions) Opti mem, by Thermo Fisher Scientific (1 mentions) Polybrene, by Merck Group (1 mentions) Puromycin, by Merck Group (1 mentions) Pfuultra 2 fusion hs dna polymerase, by Agilent Technologies (1 mentions) Pegfp c1, by Takara Bio (1 mentions) Fetal bovine serum (fbs), by Merck Group (1 mentions)

14 protocols using mutagenesis kit

1

Design and Characterization of HIV-1 gp120 Outer Domain Mutants

Check if the same lab product or an alternative is used in the 5 most similar protocols
The outer domain mutant 3 (OD3) of HIV-1 gp120 from subtype C strain 1084i essentially was designed based on the outer domain mutant 2 (OD2) structure as described previously [25] . The S375W mutation was introduced by Site-directed mutagenesis using the mutagenesis kit from Agilent. The sequences of the mutations were confirmed by DNA sequencing. The models of the OD1, OD2 and OD3 structures were predicted based on the gp120-VRC01 structure complex (PDB: 3NGB) from an HIV-1 subtype B strain, and conducted using Discovery Studio Client 4.0 (Biovia, San Diego, CA). The protein sequence numbering of OD1, OD2 and OD3 is based on the envelope sequence of the HIV-1 prototypic HXBc2 strain [26] .
Hu D., Bowder D., Wei W., Thompson J., Wilson M.A, & Xiang S.H. (2017). Tryptophan 375 stabilizes the outer-domain core of gp120 for HIV vaccine immunogen design. Vaccine, 35(23), 3067-3075.
+ Open protocol
+ Expand
2

Luciferase Assay for LUM Promoter

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The LUM promoter fragment was examined for recognition by nuclear proteins by EMSA according to a protocol previously described (38 (link)). Three oligo probes containing SBE consensus binding sites were designed and are described in Supplementary Table 1. The super-shift experiments were performed with anti-SMAD4 antibody (#SC-7966×, Santa Cruz). The three SBEs and mutant oligos were purchased from Sigma-Aldrich.
LUM promoter dual-luciferase activity was performed with a pGL2-LUM promoter construct, including part of the LUM first exon and potential SBE sites (SBE1) as previously described (38 (link)). The pGL2-LUM plasmid was co-transfected into HPSC and 293T cells with an internal control, TK-Renilla luciferase. The activities of Firefly and Renilla luciferase were determined using a dual luciferase reporter assay system (#E4550, Promega) after 48 hours of transfection. Firefly luciferase activity was normalized to the Renilla luciferase activity of the internal control. For site-directed mutagenesis assays, one base pair in the first SBE sequence in the LUM promoter region from −811 bp to −817 bp was changed using a mutagenesis kit (#200522, Agilent Technologies, Inc.).
Kang Y., Roife D., Lee Y., Lv H., Suzuki R., Ling J., Rios Perez M.V., Li X., Dai B., Pratt M., Truty M.J., Chatterjee D., Wang H., Thomas R.M., Wang Y., Koay E.J., Chiao P.J., Katz M.H, & Fleming J.B. (2016). Transforming Growth Factor-β Limits Secretion of Lumican by Activated Stellate Cells within Primary Pancreatic Adenocarcinoma Tumors. Clinical cancer research : an official journal of the American Association for Cancer Research, 22(19), 4934-4946.
+ Open protocol
+ Expand
3

Generating KRAS, NRAS, MRAS, BRAF, and IDH1 Mutants

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
KRAS, NRAS, MRAS in pENTR/D-TOPO vector (Invitrogen) were used as templates to generate KRAS(G12V), NRAS(Q61K) and MRAS(Q71R) respectively with QuickChange II site-directed mutagenesis kit (Agilent, #200523). To generate doxycycline inducible constructs, the mutants were cloned into the pInducer20 vector (Addgene #44012) using Gateway LR Clonase kit (Thermo Fisher, #11791019). sgRNA targeting SHOC2 (guide1: 5’- TCATACCTATAGTATCTGGG-3’; guide2: 5’- TAGTTATACGATTAAAGCGA-3’) were cloned into lentiCRISPRv2 plasmid (Addgene plasmid #52961) via the BsmBI site. BRAF in pDOR223 (addgene #81684) were used as template to generate BRAF(G596R) with mutagenesis kit (Agilent, #200523). pDOR223-IDH1(L302C) (Addgene #81726), together with pDOR223-BRAF(G569R) were subcloned into pLX304 vector (Addgene plasmid #25890) with Gateway LR Clonase kit (Thermo Fisher, #11791019). H358 STK11 KO and H358 KEAP1-KO cell lines were established and validated in a previous study19 (link).
Zhao Y., Murciano-Goroff Y.R., Xue J.Y., Ang A., Lucas J., Mai T.T., Da Cruz Paula A.F., Saiki A., Mohn D., Achanta P., Sisk A.E., Arora K.S., Roy R.S., Kim D., Li C., Lim L.P., Li M., Bahr A., Loomis B.R., de Stanchina E., Reis-Filho J., Weigelt B., Berger M., Riely G., Arbour K.C., Russell Lipford J., Li B.T, & Lito P. (2021). Diverse alterations associated with resistance to KRAS(G12C) inhibition. Nature, 599(7886), 679-683.
+ Open protocol
+ Expand
4

Plasmid-based PARP1 Mutagenesis Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
pCBASceI plasmid (26477), DSB reporter system plasmid (98895), mCherry HR donor plasmid (98896), and pCMV PARP1-3x-Flag (111575) were purchased from addgene. PARP1 mutants were generated using mutagenesis kit (Agilent, Santa Clara, CA, USA, 200523) according to the manufacturer’s instructions. Primer sequences for mutagenesis are listed in Supplementary Table 1.
Yang S., Hwang S., Kim B., Shin S., Kim M, & Jeong S.M. (2023). Fatty acid oxidation facilitates DNA double-strand break repair by promoting PARP1 acetylation. Cell Death & Disease, 14(7), 435.
+ Open protocol
+ Expand
5

Lentiviral Transduction of Cells with BIM, MCL-1, and BRAF Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Virus production in HEK293T cells and transduction of target cells with lentivirus were performed utilizing a standard procedure described previously (31 (link)). The non-targeting shRNA expression vector was obtained from Addgene (Cat #1864). Lentiviral BIM and MCL-1 shRNA constructs were previously described (31 (link)). Lentiviral BRAFV600E was generated by subcloning its cDNA (Addgene, Cat # 15269) into the lentiviral vector pCDH1-puro-2HA. For transduction of lentiviral constructs (packaged as pseudotyped viral particles) into target cells, the growth medium of recipient cells was replaced with OPTI-MEM (Invitrogen, Cat # 31985) containing 8 μg/ml Polybrene (Sigma, Cat # 107689) and lentivirus. The cells were incubated overnight at 37 °C, and the medium was replaced the following day. Puromycin (2– 4 μg/ml, Sigma; Cat # P8833) was added 48 h post-transduction, and the Puromycin-resistant cells were used for subsequent experiments.
Wild-type MCL-1 cDNA was purchased from Origene (Cat # RC200521). MCL-1 AA or DD mutants at T92/T163 were generated using a mutagenesis kit (Agilent, Cat # 200523) and synthesized primers containing the desired mutations, which were then cloned into retroviral pBape-puro-2HA vector.
Kawakami H., Huang S., Pal K., Dutta S.K., Mukhopadhyay D, & Sinicrope F.A. (2016). Mutant BRAF upregulates MCL-1 to confer apoptosis resistance that is reversed by MCL-1 antagonism and cobimetinib in colorectal cancer. Molecular cancer therapeutics, 15(12), 3015-3027.
+ Open protocol
+ Expand
6

Regulation of Hnf4α by miR-34a and Fatty Acids

Check if the same lab product or an alternative is used in the 5 most similar protocols
HepG2 cells were purchased from ATCC (Virginia) and cultured in DMEM plus 10% FBS. 3′-UTR of mouse Hnf4α was cloned to the Mlu/PmeI sites of pMIR-Report (catalog AM5795, Life Technologies). Potential miR-34a binding site A (232–238 nt) and site B (2710–2716 nt) were mutated using a mutagenesis kit from Agilent (catalog 210518). The forward primer sequences for the mutant binding site A (mutA) and the mutant binding site B (mutB) are 5′-gagaagaccccagggaggactgtcttcggtctagtggactcctctcaagttgaagtcatcgtc-3′ and cctaccctgat ccccaaggccccaccatggtctagcaagggggtaaaaaagagaaaaagccctc, respectively (mutations are indicated in bold). An miR-34a mimic (C-310529-07-0005) and a control mimic were purchased from Dhmarcon (Thermo Scientific). Transfections were performed using Lipofectamin 2000 (catalog 11668019, Life Technologies). The miRNA mimics were transfected at a final concentration of 50 nM. For treatment with FAs or cholesterol, HepG2 cells or primary hepatocytes were cultured in serum-free DMEM, then treated with either vehicle or palmitate (300 μM), oleic acid (300 μM), linoleic acid (300 μM) or cholesterol (10 μg/ml). Cells were harvested 48–72 hours later for luciferase or Western blot assays or lipid extraction.
Xu Y., Zalzala M., Xu J., Li Y., Yin L, & Zhang Y. (2015). A Metabolic Stress-inducible miR-34a-HNF4α Pathway Regulates Lipid and Lipoprotein Metabolism. Nature communications, 6, 7466.
+ Open protocol
+ Expand
7

Construction of FLAG-CASP2 Expression Vectors

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human FLAG‐CASP2 WT overexpression vector was constructed by PCR‐amplifying human CASP2 with cloning primers containing NgoMIV restriction site using PfuUltra II Fusion HS DNA polymerase (Agilent) from human cDNAs. FLAG‐hCASP2 A3P was generated by PCR amplifying using the same reverse cloning primer of FLAG‐CASP2 WT cloning and the forward primer replaced the third residue of CASP2 with proline. The digested insert was ligated into pBabe vector using ligase (Takara, 2011A). FLAG‐CASP2 C320G mutant was generated using mutagenesis kit (Agilent, 200523) according to the manufacturer's instructions. Primer sequences for cloning were: GCCGGCATGGCGGCGCCGAGCGCGGGG and GCCGGCTCACTTGTCGTCATCGTCTTTGTAGTCTGTGGGAGGGTGTCCTGG for human CASP2 WT with C‐terminal FLAG; GCCGGCATGGCGCCGCCGAGCGCGGGGTCTT and GCCGGCTCACTTGTCGTCATCGTCTTTGTAGTCTGTGGGAGGGTGTCCTGG for human CASP2 A3P with C‐terminal FLAG; GTTCTTCATCCAGGCCGGCCGTGGAGATGAGACTG and CAGTCTCATCTCCACGGCCGGCCTGGATGAAGAAC for human CASP2 C320G mutagenesis.
Hwang S., Yang S., Park K., Kim B., Kim M., Shin S., Yoo A., Ahn J., Jang J., Yim Y.S., Seong R.H, & Jeong S.M. (2023). Induction of Fatty Acid Oxidation Underlies DNA Damage‐Induced Cell Death and Ameliorates Obesity‐Driven Chemoresistance. Advanced Science, 11(10), 2304702.
+ Open protocol
+ Expand
8

Coactosin Expression Plasmid Construction

Check if the same lab product or an alternative is used in the 5 most similar protocols
Hemagglutinin (HA)-tagged coactosin cDNA was cloned into the pMiw expression vector (containing the Rous sarcoma virus enhancer and the beta-actin promoter) (Suemori et al., 1990 (link); Wakamatsu and Weston, 1997 (link); Sugiyama et al., 2000 (link)) and the pCAGGS expression vector [containing the cytomegalovirus (CMV) enhancer and the chicken beta-actin promoter] (Niwa et al., 1991 (link)). To generate EGFP fusion protein, coactosin (GenBank accession number AB519794) was separately inserted into pEGFP-C1 (Clontech/Takara Bio, Japan). To generate mutant coactosin, lysine75 (actin-binding site) was changed to alanine using a mutagenesis kit from (Stratagene/Agilent Technologies, United States) and inserted into pMiw and phrGFP (Clontech). Dominant–negative forms of RhoA (GenBank accession number M27278) and LIMK1 (GenBank accession number AB073752) were inserted into the pEF-BOS-HA × 3 vector (a kind gift from Dr. Kazumasa Ohashi). For visualizing LacZ or GFP in axons, tau-LacZ or tau-GFP cDNA was cloned into the pMiw expression vector.
Hou X., Nozumi M., Nakamura H., Igarashi M, & Sugiyama S. (2021). Coactosin Promotes F-Actin Protrusion in Growth Cones Under Cofilin-Related Signaling Pathway. Frontiers in Cell and Developmental Biology, 9, 660349.
+ Open protocol
+ Expand
9

Taspase1 and MLL Mutagenesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Site-directed mutagenesis of Taspase1 and the GST–MLL substrate protein was performed using a commercially available mutagenesis kit (Agilent Technologies, Böblingen, Germany) in combination with specific oligonucleotides that are listed in Suppl. Table S1.
Sabiani S., Geppert T., Engelbrecht C., Kowarz E., Schneider G, & Marschalek R. (2015). Unraveling the Activation Mechanism of Taspase1 which Controls the Oncogenic AF4–MLL Fusion Protein. EBioMedicine, 2(5), 386-395.
+ Open protocol
+ Expand
10

Characterization of TRPV1 Channel Variants

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The wildtype mouse TRPV1 complementary DNA (cDNA) was constructed into the pEYFP-N3 plasmid backbone. The cDNA of enhanced YFP was fused to the C terminus of TRPV1 cDNA to indicate the transfected cells during patch-clamp recordings. The Y512A point mutation was introduced using mutagenesis kit purchased from Agilent Technologies, as previously described (12 (link), 24 ). All the sequences of these plasmids were confirmed by sequencing. Plasmids of the TRPV1 concatemers (YYYY, YYYA, YYAA, YAAA, and AAAA) were generated by Dr Avi Priel as previously described (25 (link)). Briefly, rat TRPV1 wildtype and Y511A (equivalent to Y512A in the mouse TRPV1 channel) cDNA segments were linked with sequences encoding flexible peptide linkers to build the tandem tetrameric channel plasmids. It was observed that the activation profile of channels with four concatenated wildtype subunits closely mimicked that of channels made with monomeric wildtype subunits (25 (link)).
Li S, & Zheng J. (2023). The capsaicin binding affinity of wildtype and mutant TRPV1 ion channels. The Journal of Biological Chemistry, 299(11), 105268.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!