The largest database of trusted experimental protocols

3 protocols using myrakt delta4 129

1

Akt and MEK Pathway Activation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
5 × 104 cells were plated and transfected with control empty vector plasmid (pECE; Addgene: 26453) and constitutively active AKT plasmid (myrAkt delta4-129; Addgene: 10841). In separate experiments, the above cells were transfected with control empty vector plasmid (LZRS-Rfa; Addgene: 31601) and constitutively active MEK plasmid (L1E-1; Addgene: 21193) using lipofectamine 2000 for 48 h. Cell lysates were collected and analyzed for AKT and MEK pathway activation using western blotting.
+ Open protocol
+ Expand
2

Isolation and Purification of TF3 Monomer

Check if the same lab product or an alternative is used in the 5 most similar protocols
TF3 monomer (purity: 92.4%) was isolated and purified using previously established method (15 (link)). Wortmannin and N-[N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) were purchased from Sigma and Santa Cruz Biotechnology (Santa Cruz, CA, USA), respectively. Antibodies against phospho-Akt (Ser473) (p-Akt), Akt, phospho-p70S6 kinase (Thr421/Ser424) (p-p70S6K), p70S6K, eukaryotic initiation factor 4E-binding protein-1 (4E-BP1), HIF-1α, Notch-1, c-Jun N-terminal kinases (JNK), p38 and phosphor-Forkhead Box O1 (Thr24) (p-FoxO1) were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). Antibodies against phosphor-mammalian target of rapamycin (p-mTOR) (Ser2448), mTOR were purchased from R&D Systems (Minneapolis, MN, USA). Antibodies against phosphor-4E-BP1 (Ser65/Thr70) (p-4E-BP1), c-Myc, phosphor-extracellular signal-regulated kinases 1/2 (Thr202/Tyr204) (p-ERK1/2), ERK1/2 and GAPDH were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz). Plasmids (myrAkt delta4-129, pcDNA3-Flag mTOR wt, pWZL Neo Myr Flag RPS6KB1, pET14b PHAS-I, HA-HIF1alpha-pcDNA3, 3XFlagNICD1, pMXs-hc-Myc, ODD-Luciferase-pcDNA3, VEGF promoter, cMyc promoter (TBE1/2-wt), and pCBFRE-luc) were purchased from Addgene (Cambridge, MA, USA).
+ Open protocol
+ Expand
3

Genetic Manipulations in HEK293T and HeLa

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK 293T cells and HeLa cells were cultured in Dulbecco modified Eagle medium (DMEM) (Sigma), supplemented with 10% fetal bovine serum (Atlanta), L-glutamine (Sigma) and 100 units/ml penicillin, 100 units/ml streptomycin at 37 in 5% CO2. To specifically deplete endogenous IRS2, shRNA was constructed targeting IRS2 sequence CCGGCTTCCAGAATGGTCTCAACTA. Plk1 shRNA was designed as described targeting AAGGGCGGCTTTGCCAAGTGCTT 22 (link) and cloned into pLKO vector. For RNAi, cells were transfected with indicated shRNA constructs using Lipo2000 (Life Technologies). Two days after transfection, cells were treated with puromycin to select transfection-positive cells. Plasmid DNA was transfected with Lipo2000 (Life Technologies). IRS2-Myc was constructed by cloning IRS2-Myc from pBABE-puro-IRS2-myc into pQCXIP vector. pBABE-puro-IRS2-myc, GFP-AKT-K179M and Myr-AKT-delta 4-129 were purchased from Addgene.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!