Target protector

P19 cells (ATCC) were routinely propagated in P19 growth medium (P19GM) containing α-MEM (Hyclone), 10% FBS (Hyclone, characterized grade), 100 IU ml⁻¹ penicillin and 100 μg ml⁻¹ streptomycin (Life Technologies). HEK293T and Neuro2a cells (ATCC) were cultured in Dulbecco's modified Eagle's medium (DMEM; Hyclone) containing 10% FBS, 100 IU ml⁻¹ penicillin and 100 μg ml⁻¹ streptomycin (Life Technologies). The cells were maintained in a humidified incubator at 37 °C and 5% CO₂.
Mouse TTP was knocked down in cell lines using corresponding ON-TARGETplus mixture containing four proprietary siRNAs designed by Dharmacon/Thermo Scientific. Non-targeting control ON-TARGETplus siRNA was also from Dharmacon/Thermo Scientific. miR-9 was inactivated using either an anti-miR-9 antisense 2′OMe-RNA oligonucleotide (5′- UCAUACAGCUAGAUAACCAAAGA -3′; Dharmacon/Thermo Scientific) or a target protector (Qiagen) against the predicted miR-9-binding sequence within mouse TTP 3′ UTR (5′- CCCUCCUAAAGCAAAUAGCCAAAGCCAUUG -3′). Transfections were carried out using Lipofectamine 2,000 (Life Technologies) as recommended. To transfect cells cultured in a 60-mm dish (4 ml medium), we typically combined 200–500 pmol of an appropriate siRNA or an oligonucleotide with 10 μl of Lipofectamine 2000 pre-diluted with 250 μl of Opti-MEM I reduced serum medium (Life Technologies).

miTarget CLIC4 3′UTR target reporter and pEZX-MT05 control plasmids were obtained from Genecopoeia. The plasmids contain the CLIC4 3′UTR downstream of Gaussia luciferase (GLuc) or GLuc alone and secreted alkaline phosphatase (SEAP) for normalization. 293T cells were seeded in 48-well plates at 60,000 cells/cm². The next day, cells were transfected using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s protocol with 62.5 ng of reporter plasmid and miRNA mimics at a final concentration of 10–20 nM (Dharmacon) or target protector (QIAGEN) at 0.1–1 μM per well. Transfections were performed in antibiotic-free DMEM containing 10% FBS, and the medium was changed 24 hours after transfection. Supernatants were harvested at 48–72 hours after transfection. GLuc and SEAP activity were quantified using the Secrete-Pair Dual Luminescence Assay Kit (Genecopoeia) according to the manufacturer’s protocol. Luminescence was detected using an Infinite M200 plate reader (Tecan).