Scrambled control shrna

Full‐length human YAP ectopic expression lentivirus vector and the negative control (GeneChem, Shanghai, China) were transfected into HUVECs according to the manufacturer's instruction. YAP shRNA (5′‐CCCAGTTAAATGTTCACCAAT‐3′) and scrambled control shRNA (GenePharma, Shanghai, China) were transfected into HUVECs with the PolyJet DNA in vitro transfection reagent (SignaGen, Ijamsville, MD, USA).

SPAG6 shRNA and scrambled control-shRNA were purchased from Shanghai GenePharma Company. For shRNA transfection, 293T cells were grown to 30–50% confluence in 6-well culture plates and transfected with scrambled shRNA or SPAG6 shRNA using Lipofectamine™ LTX reagent with PLUS™ reagent (Invitrogen; Thermo Fisher Scientific, Inc.) for 48 h. Then, the supernatant from 293T cells was harvested and added to Daudi and Raji cells for 72 h, followed by selection with 1 µg/ml puromycin for 1 month. Plasmids (pcDNA3.1-SPAG6 and pcDNA3.1) were purchased from Obio Technology Co., Ltd. For plasmid transfection, CA46 and NAMALWA cells (70% confluence) were plated in 6-well culture plates. Plasmids were purified and transfected with pcDNA3.1-SPAG6 or pcDNA3.1 for 72 h using Lipofectamine™ LTX reagent with PLUS™ reagent (Invitrogen; Thermo Fisher Scientific, Inc.), followed by selection with 1 µg/ml puromycin for 1 month.