Swescript rt 1 first strand cdna synthesis kit

Total RNA was extracted from RPE cells using the EZ-press RNA Purification Kit (EZBioscience, B0004DP). RNA was reversely transcribed to complementary DNA (cDNA) by using SweScript RT I First Strand cDNA Synthesis Kit (Servicebio, G3330-100). The RT-qPCR reactions were performed using 2× SYBR Green qPCR Master Mix (Servicebio, G3322-05). The primers used in the process are provided in Table 1.
Table 1

List of primers

Gene	Primer sequence (5'-3')
β-actin	F: CCTGGCACCCAGCACAAT
	R: GGGCCGGACTCGTCATAC
Nodal	F: GCTCCTTATGCTCTACTCCA
	R: GAACTTGACCTTCCGACA
Laminin	F: GAAGACGGGAAGAAAGGG
	R: TGCAAGTGGCTGACGATA
N-cadherin	F: ATCCTACTGGACGGTTCG
	R: TTGGCTAATGGCACTTGA
E-cadherin	F: CCCCATACCAGAACCTCG
	R: TGTGCCTTCCTACAGACG

F Forward, R Reverse

A gene expression analysis was conducted according to methods in previous studies [29 (link)]. Briefly, total RNA was extracted from intestinal mucosa and liver with TRIzol reagent (Beyotime, Shanghai, China), and quantified with a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Total RNA was then reverse transcribed into cDNA with the SweScript RT I First Strand cDNA Synthesis Kit (Servicebio) according to the manufacturer’s protocol. Gene expressions responsible for cholesterol synthesis (HMGCR and SREBP-2 in liver), cholesterol absorption (NPC1L1 and LXR-α in intestine), cholesterol uptake (LXR-α, LDLR, IDOL and PCSK9 in liver), cholesterol efflux (ABCG5, ABCG8 and ABCA1 in intestine), and bile acid synthesis (CYP7A1 and FXR in liver) were quantified with a three-step RT-qPCR method using SYBR Green mixture (Takara, Tokyo, Japan) and a Quant Studio™ 6 Flex Real-Time PCR system (Thermo Fisher Scientific). Sequences of all primers (Table S1) were designed according to previous studies and were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control. Gene expression was quantified using the 2^−ΔΔCT method and expressed as a fold change normalized to the expression in CD control mice.

TRIzol reagent (Servicebio, Wuhan, China) was used to extract total RNA from subcutaneous fat and IMF, and a spectrophotometer (NanoDrop 2000, Thermo Fisher Scientific™, Waltham, America) was used to determine the absorbance of RNA at 260 and 280 nm. The RNA was then reverse-transcribed using the SweScript RT I First Strand cDNA Synthesis Kit (Servicebio, China) and random primers. qPCR was performed using a Bio-Rad CFX Connect quantitative PCR fluorescence instrument with an SYBR Green qPCR Master Mix and gene-specific primers (Table S2), and relative expression was calculated using the 2^−ΔΔCt method [21 ].

For qRT-PCR assay, RNA was retrotranscribed with the SweScript RT I First Strand cDNA Synthesis Kit (Servicebio, Wuhan, China). By using 18S rRNA as an internal control, the relative expression of circRNA was calculated by the 2^−ΔΔCT method. U6 and GAPDH were used as the endogenous controls for qRT-PCR of miRNA and mRNA, respectively on the StepOnePlus System (ABI, CA, USA). Moreover, the abundances of circRNA and linear mRNA were assessed by divergent primers and convergent primers, respectively. All primers are listed in Additional file 1: Table S1.

Total RNA from cultured HCC cell lines was extracted with Trizol reagent (Invitrogen, United States) according to the manufacturer’s instructions. 1 μg RNA samples were reverse transcribed into cDNA using a SweScript RT I First Strand cDNA Synthesis Kit (Servicebio, China). The qRT-PCR was carried out using 2 × SYBR Green qPCR Master Mix (High ROX) (Servicebio, China). All primers were listed as follows: RAB6B Forward: AGA​GGC​AGA​TAA​CCA​TCG​AGG, Reverse: CTT​CGC​ACT​GGT​CTC​AAT​GAA. GAPDH Forward: GGA​GCG​AGA​TCC​CTC​CAA​AAT, and Reverse: GGC​TGT​TGT​CAT​ACT​TCT​CAT​GG. GAPDH was utilized as the internal control.