HEK-293T cells (ATCC, USA) were transfected with circRNA_002581 overexpression plasmid or NC (empty vector), miR-122 mimics (sequence: AUCGAAUAGUCUGACUACAACUAAAAAA) or NC mimics (sequence: UCACAACCUCCUAGAAAGAGUAGA) using the Lipofectamine 2000 kit (Invitrogen, Shanghai, China) according to the manufacturer’s instructions for 48 h. NCTC-1469 cells were transfected with circRNA_002581 siRNA (sequence: AACGGCCGTGTTTTGCTGTGC) or corresponding scramble siRNA as NC (sequence: TGGTCTAACCAGAGAGACCCAGTA), miR-122 inhibitor (sequence: AUCGAAUACUCUGACUACAACU) or NC inhibitor (sequence: UCACAACCUCCUAGAAAGAGUAGA) using the Lipofectamine 2000 kit, and then treated with or without HFFA for 72 h.
Lipofectamine 2000 kit
Manufactured by Thermo Fisher Scientific
Sourced in United States, China
Lipofectamine 2000 is a transfection reagent used for the delivery of nucleic acids, such as plasmid DNA, siRNA, or microRNA, into a variety of cell lines. It facilitates the uptake of these molecules into cells, enabling efficient gene expression, gene silencing, or other genetic manipulations.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (45 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (16 mentions)
Dual luciferase reporter assay system, by Promega (10 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (9 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (7 mentions)
Mir nc, by GenePharma (7 mentions)
Pcdna3.1 vector, by Thermo Fisher Scientific (6 mentions)
Penicillin, by Thermo Fisher Scientific (5 mentions)
Streptomycin, by Thermo Fisher Scientific (5 mentions)
Si nc, by GenePharma (5 mentions)
Sh nc, by GenePharma (5 mentions)
Inhibitor nc, by GenePharma (5 mentions)
Opti mem medium, by Thermo Fisher Scientific (5 mentions)
Dual luciferase reporter assay kit, by Promega (4 mentions)
Dmem medium, by Thermo Fisher Scientific (4 mentions)
Mimic nc, by GenePharma (4 mentions)
Mir nc, by RiboBio (4 mentions)
Opti mem, by Thermo Fisher Scientific (4 mentions)
Si nc, by Thermo Fisher Scientific (4 mentions)
Si nc, by RiboBio (4 mentions)
401 protocols using lipofectamine 2000 kit
1
Exploring circRNA_002581 and miR-122 in Cellular Regulation
2
Silencing PCAT6 in A549 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The siRNA oligonucleotides were synthesized by Shanghai GenePharma Co. Ltd. (Shanghai, China), and the siRNA sequence of PCAT6 was as follow: siRNA negative control (si-NC) (5′-GCGACCAA CGCCTTGA TTG-3′) and si-PCAT6 (5′-GGTGTCTCCATCCTCATTC-3′). The si-NC was used as negative control. Cells were cultured in six-well plates overnight and then transiently transfected with PCAT6-siRNA using Lipofectamine 2000 kit (Invitrogen, Grand Island, NY, USA). In miRNAs transfection, the cells were transfected with miR-330-5p (100 nM) and negative control miRNA (miR-NC) for 24 hours using Oligofectamine (Invitrogen). For miRNA inhibitor transfection, cells were transfected with negative control miRNA inhibitor or miR-330-5p inhibitor using Lipofectamine 2000 kit (Invitrogen). The specific siRNA against PCAT6 (si-PCAT6) was designed and synthesized by GenePharma Co. Ltd. A negative control siRNA (si-Con) was synchronously synthesized. For the generation of stable cell lines, A549 cells were transfected si-PCAT6 and the transfected cells were selected with 1 µg/mL puromycin. After ~4 weeks, puromycin-resistant A549 cells were established and collected for in vivo experiments.
3
siRNA-mediated Knockdown of DNMT1 and PSMD10 in NT2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The small interfering RNAs (siRNAs) specifically targeting DNMT1 (siDNMT1), namely, si1617, si2354 and si3437, respectively, and PSMD10 (siPSMD10), namely, si373, si518 and si765, respectively, were designed and synthesized by GenePharma, Shanghai, China. The synthetic siDNMT1, siPSMD10, or negative control siRNA at a final concentration of 20 nM were introduced into NT2 cells by using Lipofectamine 2000 kit (Invitrogen, Carlsbad, CA) as previously described under Cell Culture and Transfection. Wild-type TP53 expression vector (GFP-p53, Plasmid 12091, GeneBank ID: AAD28628.1), bought from Addgene (Cambridge, MA, USA), produced the GFP-TP53 fusion protein (about 80 kDa). In addition, we re-named GFP-p53 as pEGFP-TP53, which was consistent with its vector backbone pEGFP-N1. The pEGFP-N1 vector, used as negative control, was purchased from Clontech Laboratories, Inc. (Mountain View, CA, US). The siRNAs or vectors were introduced into NT2 cells by Lipofectamine 2000 kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. Transfected cells were harvested at 24 or 48 hours to test the knock-down efficiency of siDNMT1 and siPSMD10. For downstream examination after transfection of siRNAs (siDNMT1 or siPSMD10) or vectors (pEGFP-TP53 or pEGFP-N1) in NT2 cells, the transfected cells were harvested at 48 hours.
4
GIHCG and miR-29b-3p in Esophageal Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ec-9706 and TE-10 cells were transfected with 50nM small interfering RNA targeting GIHCG (si-GIHCG), miR-29b-3p mimics, miR-29b-3p inhibitor and respective negative controls (si-NC, miR-NC and inhibitor NC) at the final concentration of 100 nM transfection reagent by the Lipofectamine 2000 kit (Invitrogen) according to the manufacturer’s instructions. The sequence of si-GIHCG and si-NC were as follows: si-GIHCG: 5′-GCATCCCGCGTCAATCTGAAGGAACCTCAAGGGA-3′; si-NC: 5′-GTTCCATCAGGATGACGCCCCTTTTGGGAAAGCCT3′. MiR-29-3p mimics, miR-NC, miR-29-3p inhibitor, and inhibitor NC were purchased from GenePharma (Suzhou, China). To construct GIHCG and ANO1 overexpressing vector, the cDNA sequences of GIHCG and ANO1 were amplified with human genome as the template and cloned into pcDNA3.1 expression vector (Geneseed Biotech, Guangzhou), and empty vector pcDNA3.1 was considered as the negative control. Plasmids were transfected into Ec-9706 and TE-10 cells also by Lipofectamine 2000 kit (Invitrogen). Cells were harvested for analyses 48 h after transfections.
5
ALL Cell Line Manipulation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasma specimens were collected from 36 cases of ALL patients and 36 healthy controls from Changyi People’s Hospital (Shandong, China). Written consent was obtained from all participants and this study was approved by the Ethics Committee from the Changyi People’s Hospital (Approval No. 2017–0009A). ALL cells (Jurkat and SUP-B15) were bought from Nanjing Cobioer Biotechnology Co., Ltd (Nanjing, China), and human peripheral blood mononuclear cells (PBMC) cells were purchased from ATCC (Manassas, VA, USA). Jurkat and SUP-B15 cell lines were subjected to cell line authentication by short tandem repeat (STR) profiling. ALL cell lines were cultured in 1640 medium (Thermo Fisher Scientific) containing 10% fetal bovine serum (FBS) in 5% CO2 at 37°C. shRNA against PVT1 (sh-PVT1 #1 and #2) and negative control sh-NC, miR-486-5p mimics and negative controls (miR-NC) as well as pcDNA3.1-PVT1 and pcDNA3.1 vector were bought from GeneCopoeia (Guangzhou, China). shRNA or miRNA mimic was transfected into Jurkat or SUP-B15 cells using a Lipofectamine 2000 kit (Thermo Fisher Scientific) for 48 hours. The ALL cell lines were separately plated in 12-well plates and cultured in the incubator (Thermo Fisher Scientific, Waltham, MA, USA) for 24 h. The cells were transfected with MAML3 siRNA or nonspecific siRNA using Lipofectamine 2000 kit (Thermo Fisher Scientific) for 48 h.
6
miR-181a-5p Regulation of CRNDE and TLR4
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CRNDE and TLR4 sequences that contained specific target sites of miR-181a-5p were connected to psi-Check2 (Promega, USA), and were then amplified through PCR. The reclaimed products were called psi-Check2-CRNDE Wt and psi-Check2-TLR4 Wt. Meanwhile, psi-Check2-CRNDE Mut and psi-Check2-TLR4 Mut were constructed following identical procedures, except that the CRNDE and TLR4 sequences were mutated in their miR-181a-5p targeting sites. In line with the guidance of Lipofectamine TM2000 kit (Invitrogen, USA), miR-181a-5p mimic and miR-NC were, respectively, co-transfected into cells with psi-Check2-CRNDE Wt, psi-Check2-CRNDE Mut, psi-Check2-TLR4 Wt and psi-Check2-TLR4 Mut. Finally, the dual-luciferase reporter assay kit (Promega, USA) was used to determine the luciferase activity of cells.
7
Silencing circRNA 0000199 in Breast Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SiRNA against hsa_circ_0000199, si-negative control (NC), miR-206 inhibitor, miR-206 mimic, miR-613 inhibitor, miR-613 mimic and miR-NC were designed and synthesized by Geenseed Biotech corporation (Guangzhou, China). They were transfected into MDA-MB-231 and MDA-MB-468 cell lines for 48 h, strictly in line with the requirements of LipofectamineTM 2000 kit (Invitrogen, USA).
8
Evaluating miR-34a in Cell Proliferation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fetal bovine serum (FBS) and DMEM medium were purchased from Gibco, US; MTT was purchased from Amresco, US; Lipofectamine TM 2000 kit was purchased from Invitrogen, US; miR-34a mimic (mimic), mimic negative control, miR-34a inhibitor (anti-miR-34a), negative control sequence (anti-miRNA-NC), SATB1 small interfering RNA (si-SATB1), and scrambled nonsense negative sequence (si-NC) were purchased from Guangzhou Ruibo Biotech Company; Trizol reagents and reverse transcription kits were purchased from Fermentas, USA; PCR kits were purchased from Dalian Bao Biological Co., Ltd.; and primer sequences were designed and synthesized by Shanghai Bioengineering Company.
9
Galectin-1 Overexpression in OVCAR-3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The galectin-1 sequences were amplified by PCR, confirmed by sequencing, and then inserted into a pIRES2-ZsGreen1 vector to generate pIRES2-ZsGreen1-galectin-1. OVCAR-3 cells were transfected with pIRES2-ZsGreen1-galectin-1 using LipofectamineTM 2000 kit (Invitrogen) to produce polyclonal cells with stable expression of galectin-1 and confirmed by western blotting.
10
Elucidating Liver Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The normal liver epithelial cell line THLE-3 and hepatocellular carcinoma cell line Hep3B, and Huh7 were obtained from ATCC (Manassas, VA, USA); Dulbecco’s Modified Eagle Medium (DMEM) and fetal calf serum, from Gibco (Grand Island, NY, USA); LipofectamineTM 2000 kit, TRIzol reagent, RNA reverse transcription kit, and PCR, from Invitrogen (Carlsbad, CA, USA); and PCR primers and bicinchoninic acid (BCA) protein detection kit, from Shanghai Shenggong Bioengineering Co., Ltd., (Shanghai, China). In addition, CCK-8 reagent was purchased from Sigma-Aldrich (St. Louis, MO, USA); crystal violet stain, from Zhongshan Golden Bridge Biotechnology Co., Ltd. (Beijing, China); Annexin V-Fluorescein Isothiocyanate (FITC)/Propidium Iodide (PI) Apoptosis Kit, from the Shanghai Meiji Biomedical Technology Co., Ltd. (Shanghai, China); Matrigel, from Sigma-Aldrich (St. Louis, MO, USA); and Transwell chamber; from the Shanghai Yanhui Biotechnology Co., Ltd., (Shanghai, China). E-cadherin, N-cadherin, and vimentin antibodies were acquired from the Santa Cruz Co., (Santa Cruz, CA, USA). pmiR-GLO luciferase reporter vector: Promega Corporation (Madison, WI, USA), dual-luciferase activity detection kits were obtained from the Shanghai Biyuntian Biotechnology Co., Ltd (Shanghai, China). Streptavidin magnetic beads were purchased from New England Biolabs (Beverly, MA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!