Western blotting was performed as previously described [40 (link)]. Briefly, C2C12 cells were lysed in a modified RIPA buffer supplemented with protease inhibitors (Pierce). Approximately 20 μg of protein from the cell homogenate preparations was separated on a 4–12% gradient gel (GenScript) via SDS-PAGE. Proteins were transferred onto Immobilon-P polyvinylidene difluoride (PVDF) membranes and blocked with 5% BSA in Tween-TBS for 1 hour. The membranes were then incubated (4°C) in 5% BSA in Tween-TBS with antibodies (1 : 1000) against PPARα, PPARδ, or GAPDH (Sigma). Following overnight incubation, the membranes were then probed with a secondary antibody (GenScript, 1 : 2000; or Thermo, 1 : 10,000). Blots were then washed and subjected to enhanced chemiluminescence (Pierce). Membranes were stripped in 0.5 M NaOH and probed for total proteins and subsequently GAPDH (Sigma) was used as a loading control.
Gapdh
Manufactured by Merck Group
Sourced in United States, United Kingdom, Germany, China, Canada, Italy, Japan, Morocco, Israel, Australia, France, Sao Tome and Principe, Denmark
GAPDH is an enzyme that catalyzes the sixth step of glycolysis, the metabolic pathway that converts glucose into energy. It is responsible for the conversion of glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate. GAPDH is commonly used as a control or reference gene in molecular biology experiments.
Automatically generated - may contain errors
Lab products found in correlation
β actin, by Merck Group (122 mentions)
Pvdf membrane, by Merck Group (86 mentions)
Bca protein assay kit, by Thermo Fisher Scientific (64 mentions)
Ripa buffer, by Thermo Fisher Scientific (61 mentions)
Flag tag (flag), by Merck Group (55 mentions)
α tubulin, by Merck Group (50 mentions)
Cleaved caspase 3, by Cell Signaling Technology (50 mentions)
Pierce bca protein assay kit, by Thermo Fisher Scientific (45 mentions)
P akt, by Cell Signaling Technology (40 mentions)
Protease inhibitor cocktail, by Roche (38 mentions)
Nitrocellulose membrane, by Bio-Rad (37 mentions)
Odyssey infrared imaging system, by LI COR (35 mentions)
Protease inhibitor cocktail, by Merck Group (35 mentions)
Vimentin, by Cell Signaling Technology (34 mentions)
E cadherin, by Cell Signaling Technology (34 mentions)
P erk, by Cell Signaling Technology (33 mentions)
Pvdf membrane, by Bio-Rad (30 mentions)
Odyssey imaging system, by LI COR (28 mentions)
Image lab software, by Bio-Rad (26 mentions)
Caspase 3, by Cell Signaling Technology (25 mentions)
1 812 protocols using gapdh
1
Western Blotting of PPAR Proteins
2
Quantifying Megalin and NGAL mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Chatsworth, CA, USA).
RNA yield and quality was determined using a NanoDrop Spectrophotometer (NanoDrop Technologies, Wilmington, Delaware USA). Complementary cDNA was generated by reverse transcription of 2 μg of high quality total RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). The measurement of Megalin and NGAL mRNA levels was performed by SYBR green qRT-PCR analysis using the ABI Prism 7900 Sequence Detection System (Applied Biosystems, Foster City, CA) and SYBR FAST (Applied Biosystems, Foster City, CA). The following primers were used: Megalin forward 5′GCCGATGCATTTATCAAAAC3′, Megalin reverse 5′TCACATCCATCTTCATCTCC3′, NGAL forward 5′GGAAAAAGAAGTGTGACTACTG3′, NGAL reverse 5′GTAACTCTTAATGTTGCCCAG3′, GAPDH forward 5′ACAGTTGCCATGTAGACC3′, GAPDH reverse 5′TTTTTGGTTGAGCACAGG3′ (Sigma Aldrich, St. Louis, Missouri, USA). Relative quantification was performed using the standard curve method. The results for the target gene expression were normalized on GAPDH as the endogenous control, and the mean values of the vehicle were set as the calibrator.
RNA yield and quality was determined using a NanoDrop Spectrophotometer (NanoDrop Technologies, Wilmington, Delaware USA). Complementary cDNA was generated by reverse transcription of 2 μg of high quality total RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). The measurement of Megalin and NGAL mRNA levels was performed by SYBR green qRT-PCR analysis using the ABI Prism 7900 Sequence Detection System (Applied Biosystems, Foster City, CA) and SYBR FAST (Applied Biosystems, Foster City, CA). The following primers were used: Megalin forward 5′GCCGATGCATTTATCAAAAC3′, Megalin reverse 5′TCACATCCATCTTCATCTCC3′, NGAL forward 5′GGAAAAAGAAGTGTGACTACTG3′, NGAL reverse 5′GTAACTCTTAATGTTGCCCAG3′, GAPDH forward 5′ACAGTTGCCATGTAGACC3′, GAPDH reverse 5′TTTTTGGTTGAGCACAGG3′ (Sigma Aldrich, St. Louis, Missouri, USA). Relative quantification was performed using the standard curve method. The results for the target gene expression were normalized on GAPDH as the endogenous control, and the mean values of the vehicle were set as the calibrator.
3
Western Blot Analysis of Mitochondrial Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total proteins were extracted and subjected to 10% or 15% polyacrylamide gels electrophoresis. Nonspecific binding sites were blocked with 5% nonfat dry milk for 1 hour at room temperature. Then, membranes were incubated with specific primary antibodies overnight at 4°C, including SIRT1 (Cell Signaling Technology, USA), Bax (CST, USA), Bcl-2 (CST, USA), Pink1 (CST, USA), Parkin (CST, USA), LC3B (CST, USA), mtTFA (NOVUS, USA), and GAPDH (Sigma-Aldrich, USA). After the incubation with horseradish peroxidase-conjugated secondary antibodies (ZSGB-BIO, Beijing, China) for 2 hours at room temperature, the immunoreactive band signal intensity was subsequently visualized by chemiluminescence (SuperSignal™ West Femto Maximum Sensitivity Substrate) (Thermo Fisher Scientific, USA). All immunoblots were normalized for gel loading with GAPDH (Sigma-Aldrich, USA) antibody. The intensities of chemiluminescent bands were measured by ImageJ software (National Institutes of Health, USA).
4
Enzyme-coupled Assay for Detecting (d-GAP)
5
Western Blot Analysis of Epithelial-Mesenchymal Transition
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were collected and lysed with RIPA lysis buffer (Co Win Biosciences, China) according to the manufacturer’s instructions, and proteins were harvested. Protein quantification was performed using a BCA Protein Quantification Kit (Thermo, USA), and samples were adjusted to the same concentration. After boiling in 6 × Loading Buffer for 5 min, the proteins were separated by SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, USA). The membrane was incubated overnight at 4 °C with the appropriate primary detection antibodies: GAPDH (Sigma, 1:1,000), α-Tubulin (Sigma, 1:600), Snail (Cell Signaling Technology, 1:1,000), and Vimentin (Cell Signaling Technology, 1:1,000); AKT (ProteinTech, 1:1,000) and p-AKT (ProteinTech, 1:1,000). After washing three times with TBST for 5 min, the membrane was incubated with secondary antibodies (Cell Signaling Technology, 1:1,000) for 1 h at 37 °C. After washing three times with TBST for 15 min each time, the protein bands were visualized by fluorography using an enhanced chemiluminescence system (Millipore, USA); the expression levels of α-Tubulin and GAPDH were used as internal references.
6
Assaying Protein Interactions and Modifications
7
Protein Expression Analysis of BC Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 30 pairs of primary BC fresh tissues and cells were lysed with radioimmunoprecipitation assay (RIPA) lysis buffer (strong; Beyotime, China) in the presence of protease inhibitors (Roche). Equal amounts of cellular proteins were loaded into each well and resolved using 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gels. The samples were heated for 5 min at 95°C. Polyvinylidene fluoride membrane blotting was subsequently performed under standard conditions. For immunoblotting, the following primary antibodies were used against pEGFR (ab40815; Abcam, US), EHD1 (ab51504; Abcam, Hong Kong), RAB11FIP3 (ZM-0442; ZSGB-BIO, China), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Sigma). The primary antibody solution was diluted 1:1000 and incubated with the membrane overnight at 4°C. The primary antibody against GAPDH (Sigma) solution was diluted 1:5000 and incubated with the membrane overnight at 4°C. The membrane was subsequently washed three times for 10 min with a mixture of tris-buffered saline and Tween 20 (TBS-T) prior to adding a 1:5000 dilution of the secondary antibody, which was diluted in the TBS-T solution at room temperature. The membrane was then incubated on a swing bed for 1 h prior to three 10-min washes with TBS-T.
8
Western Blot Analysis of Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples from the mouse cerebral cortex or BV2 cultures were homogenized in lysis buffers, and total protein was isolated as described previously53 (link). Protein was loaded onto an SDS polyacrylamide gel. After electrophoresis, the protein was transferred onto a PVDF membrane (Millipore, Billerica, MA, USA). The membrane was incubated with the following antibodies at 4 °C overnight: CD16/32, CD206, Notch1 (1:500, Sigma, St Louis, MO, USA) and GAPDH (1:2000, Millipore) and then with the HRP-conjugated secondary antibodies for 45 min at room temperature, GAPDH was used as an internal control. Next, the membranes were incubated with and detected using an enhanced chemiluminescence detection system (Pierce, Rockford, USA).
9
Protein Expression Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total protein was extracted by RIPA buffer (Solarbio, Beijing, China). 50 μg protein was put into 5 × loading buffer (4 : 1), 100°C water bath for 10 min, and SDS-PAGE electrophoresis and transferred to polyvinylidene fluoride (Millipore, Darmstadt, Germany). PVDF was blocked by 5% nonfat milk. Specific primary antibody was added (RUNX3 and MMP2/9: 1:1500; GAPDH: 1 : 150) (CST Signaling Technology, Danvers, USA) and incubated at 4°C overnight. After washing with TBST, second antibody (1 : 1500) was incubated at 37°C for 1 h. After washing with TBST, ECL (Millipore, Darmstadt, Germany) was applied, and RUNX3/GAPDH and MMP2/9/GAPDH were used for quantitative determination.
10
Protein Quantification and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Proteins were quantified and subjected to Western blot. The primary antibodies against GAPDH (1:1000), cleaved‐Caspase3 (1:500), or NOX4 (1:500) were used to incubate the membrane at 4°C for 16 h, and then secondary antibodies were used for 1 h. Their intensity was analyzed using ImageJ 1.43 and normalized to GAPDH (Millipore).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!