Sybr green real time pcr master mix

The protocols for RNA isolation and the qRT–PCR assay were specifically described in our previous publication [8 (link)]. Briefly, total RNA from PBMCs was extracted using 200 µl chloroform. It was then precipitated with an equal volume of isopropanol and washed with 1 ml of 75% ethanol. Then, after drying for 5 min, it was dissolved in RNase-free water. The quantity and quality of RNA were evaluated by means of a NanoDrop 2000 (NanoDrop Products, Wilmington, DE).
Using the primers listed in Table 1, a total of 500 ng of RNA was used as a template to prepare cDNA for PCR analysis. SYBR Green Real-time PCR Master Mix (Vazyme, Nanjing, China) in a StepOnePlus (Applied Biosystems) instrument was used to quantify the expression level of BTBD7_hsa_circ_0000563. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used for internal normalization. The relative fold-change was calculated using the 2^−ΔΔCt method normalized to GAPDH. All experiments were performed in triplicate. Identification of BTBD7_hsa_circ_0000563 as a circRNA was conducted via Sanger sequencing following PCR.
Table 1

The oligonucleotide sequences of the primers for qRT–PCR

	Forward primer	Reverse primer
GAPDH	GTCTCCTCTGACTTCAACAGCG	ACCACCCTGTTGCTGTAGCCAA
BTBD7_hsa_circ_0000563	ATGCTTGCACAAGAAATGGA	GAACATGAATGAGGATAATTAG

GAPDH, glyceraldehyde-3-phosphate dehydrogenase

Total RNAs were extracted from different tissues of cotton or Arabidopsis plants using TRIzol reagent (TIANGEN, Beijing, China) and treated with DNase I in accordance with the manufacturer’s protocol. In total, 1 μg of total RNA was reverse transcribed using a cDNA synthesis kit, version R323 (Vazyme, Nanjing, China). The RT-PCR analyses were performed as described previously (Hu et al., 2018 (link)). The qRT-PCR assays were performed using SYBR Green Real-time PCR Master Mix (Vazyme) on a LightCycler480 system (Roche, Germany). PCR amplification parameters were as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. The cotton Histone3 or Arabidopsis Actin2 gene was used as an internal control. The primers used in the RT-PCR and qRT-PCR are listed in Supplementary Table 1.

qRT-PCR was used to detect the RNA expression of METTL14 and miR-1306-5p. All the RNA was collected from blood, cell, or tissue samples using the miRNeasy extraction kit (QIAGEN). For quantitative analysis, the cDNA was reversed by miRNA Reverse Transcription Kit (MR101-01/02, Vazyme) and detected by all-in-one miRNA RT-qPCR Detection Kit (Q711-02, Vazyme) with U6 as the internal control. As for METTL14 mRNA detection, TRIzol (BS259A, Biosharp) was used for RNA isolation and PrimeScript RT Reagent kit (R223-01, Vazyme) was used to reverse RNA into cDNA. SYBR Green Real-Time PCR Master Mix (Q711-02, Vazyme) was used for RT-PCR assay with β-actin as the control. The primers for miR-1306-5p, U6, METTL14, and β-actin were listed as below: METTL14, sense, 5′- GAGTGTGTTTACGAAAATGGGGT-3′; antisense, 5′- CCGTCTGTGCTACGCTTCA-3′; β-actin: sense, 5′-AGCGAGCATCCCCCAAAGTT-3′, antisense: 5′-GGGCACGAAGGCTCATCATT-3′; U6: sense, 5′-CTCGCTTCGGCAGCACA-3′, antisense: 5′-AACGCTTCACGAATTTGCGT-3′; miR-1306-5p reverse primer: 5′-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTGGACGTT-3′; miR-1306-5p sense: 5′-AATACCACCTCCCCTGCA-3′. 2^−ΔΔCt method was used for analysis of relative expression.