Nico21 de3

Manufactured by New England Biolabs

Sourced in United States

NiCo21(DE3) is an Escherichia coli strain designed for the expression of recombinant proteins. It is a derivative of the BL21(DE3) strain, which is commonly used for protein expression. NiCo21(DE3) contains additional genetic modifications to enhance the expression of certain types of proteins.

Automatically generated - may contain errors

Lab products found in correlation

Histrap ff, by GE Healthcare (2 mentions) Akta pure, by GE Healthcare (2 mentions) Vivaspin 20 ultrafiltration unit, by Sartorius (2 mentions) Qubit protein assay kit, by Thermo Fisher Scientific (2 mentions) Complete edta free, by Roche (2 mentions) Sodium chloride (nacl), by Merck Group (2 mentions) Bl21 star de3, by Thermo Fisher Scientific (2 mentions) Dh10b, by Thermo Fisher Scientific (2 mentions) Chloroform, by Thermo Fisher Scientific (1 mentions) Tri reagent, by Molecular Research Center (1 mentions) Escherichia coli xl 1 blue, by New England Biolabs (1 mentions) Terrific broth, by Merck Group (1 mentions) Luria bertani broth, by Merck Group (1 mentions) Pet30b, by New England Biolabs (1 mentions) Bl21 de3, by New England Biolabs (1 mentions) Hela s3 cells, by American Type Culture Collection (1 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions) Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions) By4741, by Horizon Discovery (1 mentions)

Close spelling variants of this product

NiCo21(DE3) competent Escherichia coli Escherichia coli NiCo21 (DE3) cells E. coli NiCo21 (DE3) cells E. coli NiCo21(DE3) Nico21(DE3) Escherichia coli E. coli strain NiCo21(DE3) NiCo21 (DE3) cells

14 protocols using nico21 de3

Preparation of RNAP Core and Holoenzyme

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNAP core enzyme was prepared from E. coli strain NiCo21(DE3) (New England Biolabs) containing plasmid pIA900 (10) using procedures described in (4) .
Bpa-containing RNAP core enzyme derivatives, RNAP-b¢ R1148Bpa and RNAP-b¢ T48Bpa , were prepared from E. coli strain NiCo21(DE3) (New England Biolabs) containing plasmid pIA900-RNAP-b¢ R1148Bpa or plasmid pIA900-RNAP-b¢ T48Bpa (4) and plasmid pEVOL-pBpF (5), using procedures described in (4) . Wild-type s 70 was purified using procedures described in (11) . Bpa-containing s 70 derivative, s 70 R448Bpa , was prepared from E. coli strain DH10B (Invitrogen) containing plasmid ps 70 -R448Bpa-His 10 using procedures described in (4). s 70 C541, P607 was prepared from E. coli strain BL21 Star (DE3) (Invitrogen) containing pLHN12-His-(R541C, L607P) using procedures described in (2) . RNAP s 70 holoenzyme was prepared by incubating 1 µM E. coli RNAP core enzyme and 5 µM E. coli s 70 in 10 mM Tris-Cl (pH 8.0), 100 mM KCl, 10 mM MgCl2, 0.1 mM EDTA, 1 mM DTT, and 50% glycerol for 30 min at 25°C. GreB was purified using procedures described in (12) .

Pukhrambam C., Molodtsov V., Kooshkbaghi M., Tareen A., Vu H., Skalenko K.S., Su M., Zhou Y., Winkelman J.T., Kinney J.B., Ebright R.H., & Nickels B.E. (2022). Structural and mechanistic basis of σ-dependent transcriptional pausing.

+ Open protocol

+ Expand

RNA extraction and primer extension in E. coli

Check if the same lab product or an alternative is used in the 5 most similar protocols

E. coli strain NiCo21(DE3) (New England BioLabs) transformed with plasmid pCDF-CP-lacCONS-GGG or pCDF-CP-lacCONS-CCT was plated on LB agar (Sambrook and Russell, 2001 ) containing 50 μg/ml spectinomycin and 50 μg/ml streptomycin, single colonies were inoculated into 25 ml LB broth (Sambrook and Russell, 2001 ) containing 50 µg/ml spectinomycin and 50 µg/ml streptomycin in 125 ml Bellco flasks, and cultures were shaken (220 rpm) at 37°C. When cell densities reached OD₆₀₀ = 0.6, 2 ml aliquots were centrifuged 2 min at 4°C at 23,000xg, and resulting cell pellets were frozen at −80°C. Cell pellets were thawed in 1 ml TRI Reagent (Molecular Research Center) at 25°C for 5 min, completely re-suspended by pipetting up and down, incubated 10 min at 70°C, and centrifuged 2 min at 25°C at 23,000 x g. Supernatants were transferred to fresh 1.7 ml microfuge tubes, 200 µl chloroform (Ambion) was added, vortexed, and samples were centrifuged 1 min at 25°C at 23,000 x g. Aqueous phases were transferred to a fresh tube and nucleic acids were extracted with acid phenol:chloroform (Sambrook and Russell, 2001 ). Nucleic acids were recovered by ethanol precipitation (Sambrook and Russell, 2001 ), and re-suspended in 20 μl 10 mM Tris-Cl, pH 8.0. Primer extension was performed as described in the preceding section.

Yu L., Winkelman J.T., Pukhrambam C., Strick T.R., Nickels B.E, & Ebright R.H. (2017). The mechanism of variability in transcription start site selection. eLife, 6, e32038.

+ Open protocol

+ Expand

Preparation of RNAP Holoenzyme and Derivatives

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Wild-type RNAP core enzyme was prepared from E.
coli strain NiCo21(DE3) (New England Biolabs) containing
plasmid pIA900 (Artsimovitch et al.,
2003) using procedures described in (Winkelman et al., 2015 (link)).
Bpa-containing RNAP core enzyme derivatives RNAP-β’
^R1148Bpa and βD446A RNAP-β’
^R1148Bpa were prepared from E. coli strain
NiCo21(DE3) (New England Biolabs) containing plasmid pEVOL-pBpF and plasmid
pIA900-RNAP-β’ ^R1148Bpa (Winkelman et al., 2015 (link)) or plasmid
pIA900-βD446A RNAP-β’ ^R1148Bpa, using
procedures described in (Winkelman et al.,
2015).
Wild-type σ⁷⁰ or a σ⁷⁰derivative containing a deletion of the σ finger (residues
513–519), were prepared from E. coli strain
NiCo21(DE3) containing plasmid pσ⁷⁰-His (gift of J.
Roberts; Marr and Roberts, 1997 (link)) or
plasmid pσ⁷⁰-His Δ finger using procedures
described in (Marr and Roberts,
1997). To form RNAP holoenzyme, 1 μM RNAP core enzyme and 5
μM wild-type σ⁷⁰ or Δ finger
σ⁷⁰ in 10 mM Tris-Cl (pH 8.0), 100 mM KCl, 10 mM
MgCl₂, 0.1 mM EDTA, 1 mM DTT, and 50% glycerol were incubated
for 30 min at 25°C. GreB was purified using procedures described in
(Borukhov et al., 1993 (link)).

Winkelman J.T., Pukhrambam C., Vvedenskaya I.O., Zhang Y., Taylor D.M., Shah P., Ebright R.H, & Nickels B.E. (2020). XACT-seq comprehensively defines the promoter-position and promoter-sequence determinants for initial-transcription pausing. Molecular cell, 79(5), 797-811.e8.

+ Open protocol

+ Expand

Bacterial Strains and Molecular Tools

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bacterial strains, plasmids, and primers used in this work are listed in Table 6. C. perfringens NCTC 8237, NCTC 13110, and NCTC 8084 were used as donors of DNA. C. perfringens isolates were grown overnight under anaerobic conditions in Schaedler Anaerobe Broth and BBL Fluid Thioglycolate Medium at 37 °C.
Escherichia coli XL-1 Blue and NiCo21(DE3) (New England BioLabs, Ipswich, MA, USA) were used for DNA manipulation and toxins production, respectively. E. coli strains were grown at 37 °C aerobically on Luria-Bertani agar plates or in Luria-Bertani (LB) broth (Sigma Aldrich, St. Louis, MS, USA). Inducible production of proteins in E. coli NiCo21(DE3) was carried out in Terrific Broth (Merck) under shaking at 200 rpm. Kanamycin (50 µg/mL) was added to the medium. Enzymes for DNA cloning were supplied by New England BioLabs (NEB). Unless otherwise stated, all other reagents were from SERVA, Qiagen, or TaKaRa. All oligonucleotide primers were synthesized by Generi Biotech (Hradec Králové, Czech Republic). General genetic techniques for Clostridium and E. coli have been described previously [26 (link),27 ].

Duracova M., Klimentova J., Myslivcova Fucikova A., Zidkova L., Sheshko V., Rehulkova H., Dresler J, & Krocova Z. (2019). Targeted Mass Spectrometry Analysis of Clostridium perfringens Toxins. Toxins, 11(3), 177.

+ Open protocol

+ Expand

Purification of M1 N-terminal Domain

Check if the same lab product or an alternative is used in the 5 most similar protocols

The N-terminal domain (1–165 aa) of M1 was subcloned into pET30b (Novagen) from a pHW2000 plasmid expressing the full-length A/WSN/33 M1 [10] (link) at the cloning sites of Nde1+Xho1. The new plasmid pET30b-M1wt-1–165 with a His-tag at the N-terminus (5′-primer: actagccatatgcaccatcatcatcatcatagtcttctaaccgaggtc; 3′-primer: tctgatctcgagctacatttgcctatgagaccgatg) was expressed in E. coli strain Nico21(DE3) (NEB). The His-tagged N^1–165-domain of M1 was further purified by affinity chromatography in combination with FPLC columns (Excellgen, MD) with the purity>90% by SDS-PAGE analysis. The recombinant protein was kept in 55 mM KH₂PO₄/K₂HPO₄, 0.2 M NaCl, 2 mM TCEP buffer at pH 4.0.

Safo M.K., Musayev F.N., Mosier P.D., Zhou Q., Xie H, & Desai U.R. (2014). Crystal Structures of Influenza A Virus Matrix Protein M1: Variations on a Theme. PLoS ONE, 9(10), e109510.

+ Open protocol

+ Expand

Recombinant Protein Purification from E. coli

Check if the same lab product or an alternative is used in the 5 most similar protocols

The effector or accessory protein expression construct was transformed into an E. coli T7 expression strain, NiCo21(DE3) (New England Biolabs) and grown as described in the Experimental Models and Subject Details section of the STAR methods. The cells were harvested by centrifugation and cell paste was resuspended in 80 ml of freshly prepared Lysis Buffer (50 mM Hepes pH 7.6, 0.5M NaCl, 10 mM imidazole, 14 mM 2-mercaptoethanol and 5% glycerol) supplemented with protease inhibitors (cOmplete, EDTA-free, Roche Diagnostics Corporation). The resuspended cells were broken by passing through a cell disruptor (Constant System Limited). Lysate was cleared by centrifugation twice at 28,000g for 30 min each. The clarified lysate was applied to a 5 ml HisTrap FF chromatography column (GE Life Sciences). Protein purification was performed via FPLC (AKTA Pure, GE Healthcare Life Sciences). After washing with Lysis Buffer, protein was eluted with a gradient of 10 mM to 250 mM of imidazole. Fractions containing protein of the expected size were pooled, concentrated in Vivaspin 20 ultrafiltration unit (Sartorius) and either used directly for biochemical assays or frozen at −80°C for storage. Protein purity was determined by SDS-PAGE analysis and protein concentration was determined by Qubit protein assay kit (Thermo Fisher).

Yan W.X., Chong S., Zhang H., Makarova K.S., Koonin E.V., Cheng D.R, & Scott D.A. (2018). Cas13d is a compact RNA-targeting type VI CRISPR effector positively modulated by a WYL domain-containing accessory protein. Molecular cell, 70(2), 327-339.e5.

+ Open protocol

+ Expand

Bacterial Cloning and Mammalian Cell Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols

E. coli DH5α strain was used for cloning, E. coli BL21(DE3) or NiCo21(DE3) were used for protein expression (New England Biolabs). Bacteria were grown in LB-Miller medium, supplemented with antibiotic (ampicillin 100 μg/mL or kanamycin 30 μg/mL) when necessary. HeLa cells (HeLa-S3 cells, ATCC) were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Life Technologies), supplemented with 10% heat-inactivated fetal bovine serum (FBS, Gibco) and 1% antibiotics (penicillin/streptomycin), at 37°C in a humidified atmosphere containing 5% CO2, and subcultured approximately every 2–3 days. All chemicals and reagents were purchased from Sigma.

Pons B.J., Bezine E., Hanique M., Guillet V., Mourey L., Chicher J., Frisan T., Vignard J, & Mirey G. (2019). Cell transfection of purified cytolethal distending toxin B subunits allows comparing their nuclease activity while plasmid degradation assay does not. PLoS ONE, 14(3), e0214313.

+ Open protocol

+ Expand

Bacterial Protein Expression and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Expression vectors for protein purification (Key Resources Table) were grown in the E. coli T7 expression strain, NiCo21(DE3) (New England Biolabs). 1mL of overnight culture was inoculated into 1 liter of Luria-Bertani broth growth media (10g/L tryptone, 5 g/L yeast extract, 5g/L NaCl, Sigma) supplemented with 50 µg/mL Kanamycin. Cells were grown at 37°C to a cell density of 0.5–0.8 OD600. Protein expression was then induced by supplementing with IPTG to a final concentration of 0.2 mM and the culture continued to grow for 14–18 hours at 20°C.

+ Open protocol

+ Expand

Recombinant Protein Purification from E. coli

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Cloning and Expression of S. cerevisiae Arl1 and Gea2

Check if the same lab product or an alternative is used in the 5 most similar protocols

The gene sequences encoding S. cerevisiae Arl1 and Gea2 were PCR-amplified from genomic DNA of S. cerevisiae BY4741 obtained from Horizon Discovery (Waterbeach, UK) with pairs of primers 5′-GTCTCTCCCATGGGTAACATTTTTAGTTCAATGTTTG-3′/5′-GGTTCTCCCCAGCTAACTGTTCCTCTTTTATAA-3′ and 5′-TACTTCCAATCCAATGCAATGAGTGATAGGGAATTCGTC-3′/5′-TTATCCACTTCCAATGCCTTAATCCTTTTCTACATCAGATAACTTC-3′, respectively. The genes were inserted using ligation-independent cloning into vectors acquired from the DNASU Plasmid Repository (Tempe, AZ), pMCSG28 for the expression of Arl1 and pMCSG21 for the expression of Gea2. Using Q5 site-directed mutagenesis kit (New England Biolabs, Ipswich, MA), expression vectors for Q72L Arl1 and also an N-terminal 17-residue truncated Q72L Arl1 (termed “ΔNT17 Q72L Arl1”) were also generated. After DNA sequence verification (GENEWIZ, South Plainfield, NJ), the E. coli strain NiCo21(DE3) (New England Biolabs, Ipswich, MA) was transformed with constructed vectors. To overcome codon bias, an additional plasmid pRARE2 isolated from E. coli strain Rosetta 2 (Novagen, Madison, Wisconsin) was also included in the transformation for Gea2 expression. The expressed protein Arl1 had a C-terminal 6xHis-tag, and Gea2 had an N-terminal 6xHis-tag to facilitate their purifications individually.

Duan H.D., Jain B.K., Li H., Graham T.R, & Li H. (2024). Structural insight into an Arl1–ArfGEF complex involved in Golgi recruitment of a GRIP-domain golgin. Nature Communications, 15, 1942.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!