Abi prism 3130 dna analyzer

Manufactured by Thermo Fisher Scientific

Sourced in United States

The ABI PRISM 3130 DNA Analyzer is a capillary electrophoresis-based genetic analysis system designed for DNA sequencing and fragment analysis. The instrument utilizes four-color fluorescence detection technology to analyze DNA samples.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

ABI Prism 3130 (153 citations) ABI 3130 (108 citations) ABI 3130 DNA Analyzer (25 citations) PRISM 3130 (10 citations) 3130 DNA Analyzer (9 citations) ABI prism 3130 DNA Genetic Analyzer (6 citations) ABI prism 3130 analyzer (3 citations) ABI Prism 3130 DNA (3 citations) Prism 3130 DNA Analyzer (2 citations) ABI Prism 3130×l DNA Analyzer (2 citations)

10 protocols using abi prism 3130 dna analyzer

Molecular Identification of Fusarium Isolates

Check if the same lab product or an alternative is used in the 5 most similar protocols

The strains were grown in yeast extract sucrose (YES) agar [44 (link)] for 3 days at 25 °C. The DNA was extracted using DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions.
The partial sequences of elongation factor (EF-1α) and the second fragment of RPB2 (7CF/11AR) were selected in order to identify the Fusarium isolates. The amplification of the EF-1α and RPB2 loci were performed according to [45 (link),46 (link)]. Amplicons were purified with ExoSAP-IT (Affymetrix, Santa Clara, CA, USA) and sent to the Centre of Human Genome Studies, University of Sao Paulo, Brazil for sequencing in ABI PRISM 3130 DNA Analyzer (Applied Biosystems, Foster City, CA, USA).
Sequences were aligned using the multiple alignment software ClustalX v. 1.83 plug-in in the software Geneious v. 5.3.6 (Biomatters, Auckland, New Zealand). The alignments were edited using the sequence alignment-editing program Geneious v. 1.83 and each polymorphism was re-examined by checking the chromatograms. The sequences generated in this study were deposited in the GenBank (Table 1 and Table S1).

Piacentini K.C., Rocha L.O., Savi G.D., Carnielli-Queiroz L., De Carvalho Fontes L, & Correa B. (2019). Assessment of Toxigenic Fusarium Species and Their Mycotoxins in Brewing Barley Grains. Toxins, 11(1), 31.

+ Open protocol

+ Expand

Microsatellite Instability Detection Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Detection of microsatellite instability was done through polymerase chain reaction and fragment analysis of a mononucleotide repeat pentaplex panel to identify alterations of repetitive tandem regions as previously described [25 (link)]. Briefly, in-house primers used the following sequences for SLC7A8, NR21-Fw: 5′-TAAATGTATGTCTCCCCTGG-3′, NR21-Rv: 5′-ATTCCTACTCCGCATTCACA-3′, ZNF-2, NR-24-Fw: 5′-CCATTGCTGAATTTTACCTC-3′, NR-24-Rv: 5′-ATTGTGCCATTGCATTCCAA-3′, inhibitor of apoptosis protein-1 NR-27-Fw: 5′-AACCATGCTTGCAAACCACT-3′, NR-27-Rv: 5′-CGATAATACTAGCAATGACC-3′, c-KIT BAT-25-Fw: 5′-TACCAGGTGGCAAAGGGCA-3′, BAT-25-Rv: 5′-TCTGCATTTTAACTATGGCTC-3′ and MSH2 BAT-26-Fw: 5′-TGACTACTTTTGACTTCAGCC-3′, BAT-26-Rv: 5′-AACCATTCAACATTTTTAACCC-3′) for multiplex amplification of purified DNA. Resulting amplicons were sequenced on the ABI-Prism 3130 DNA analyzer (Applied Biosystems, Foster City, CA, USA). Fragments were analyzed with the Peak Scanner^TM 2 software (ThermoFisher Scientific, Waltham, MA, USA) and instability assessment was defined as a loss of stability in two or more repeats out of the five microsatellite markers [26 (link)].

Prieto-Potin I., Idrovo F., Suárez-Gauthier A., Díaz-Blázquez M., Astilleros-Blanco de Córdova L., Chamizo C., Zazo S., Carvajal N., López-Sánchez A., Pérez-Buira S., Aúz-Alexandre C.L., Manso R., Plaza-Sánchez J., de Lucas-López V., Pérez-González N., Martín-Valle S., Cristóbal I., Casado V., García-Foncillas J, & Rojo F. (2022). Comprehensive Approach to Genomic and Immune Profiling: Insights of a Real-World Experience in Gynecological Tumors. Diagnostics, 12(8), 1903.

+ Open protocol

+ Expand

DNA Extraction and Genetic Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peripheral blood in ethylene diamine tetraacetic acid-containing (EDTA) collection tubes was used to extract genomic DNA (standard phenol-cloroform method). DNA was amplified using the polymerase chain reaction (PCR): PCR mix (50 μL) contained 200 ng of genomic DNA, 1.5 μL of 10 pmol primers, 5 μL of buffer 10x, 1.5 μL of MgCI₂ 50 mmol, 1 μL of 40 mmol dNTP and 2.5 U of Taq polymerase enzyme (Invitrogen Corp., Carlsbad, CA, USA). PCR products were analyzed on SYBR-Safe 3% agarose gel and displayed to the ultraviolet lamp. PCR products were sequenced bidirectional directly using Big-Dye terminator 3.1 cycle sequencing kit and run on ABI PRISM 3130 DNA analyzer (Applied Biosystems, Foster City, CA). Primers used for PCR and sequencing were designed in our laboratory (Table 2). Mutations in KLF-1 were detected by DNA sequencing of exon 2; mutations of BCL11A were found by sequencing of the 5 exons and the two intronic regions containing SNP rs11886868 and rs4671393. For the analysis of GATA1 gene the entire codifying region (6 exons) was sequenced. Also the XmnI genotype was obtained by XmnI enzymatic restriction. The PCR conditions will be made available upon request.

Sclafani S., Pecoraro A., Agrigento V., Troia A., Di Maggio R., Sacco M., Maggio A., D’Alcamo E, & Di Marzo R. (2016). Study on Hydroxyurea Response in Hemoglobinopathies Patients Using Genetic Markers and Liquid Erythroid Cultures. Hematology Reports, 8(4), 6678.

+ Open protocol

+ Expand

Molecular Serotyping of E. coli

Check if the same lab product or an alternative is used in the 5 most similar protocols

Molecular serotyping was performed on all E. coli isolates using PCR to detect the serogroup O157 and the H7 antigen (Table 1). The obtained PCR products were sequenced using an ABI PRISM 3130DNA Analyzer and the data were processed with the Sequencing Analysis 3.3 software (Applied Biosystems).

Ghita B.T., Bennani L., Berrada S., Benboubker M, & Bennani B. (2020). Molecular Serotyping and Antibiotic Resistance Patterns of Escherichia coli Isolated in Hospital Catering Service in Morocco. International Journal of Microbiology, 2020, 5961521.

+ Open protocol

+ Expand

Sanger Sequencing of PCR Products

Check if the same lab product or an alternative is used in the 5 most similar protocols

After purification with Thermo Fisher Scientific PCR ExoSAP-IT^TM (Waltham, MA, USA), HRM products were sequenced using Applied Biosystems Big Dye Terminator v1.1 and v3.1 kits (Applied Biosystems, Foster City, CA, USA) and an ABI PRISM 3130 DNA Analyzer (Applied Biosystems, Foster City, CA, USA). The obtained sequences were analyzed with BioEdit v.7.2 software (Ibis Biosciences, Carlsbad, CA, USA) and the NCBI Nucleotide Blast platform (Blastn) [26 ]. Nucleotide sequences were translated using the translate tool in the ExPASy Bioinformatics Resource Portal [27 ]. Whenever a sequence variant was found, the sample was sequenced again from the opposite direction to confirm the nucleotide change.

Rogel-Ayala D.G., Muñoz-Medina J.E., Vicente-Juárez V.D., Grether-González P., Morales-Barquet D.A., Martínez-García A.D., Echaniz-Aviles M.O., Sevilla-Montoya R., Martínez-Juárez A., Artega-Vázquez J., Angeles-Martínez J., Vargas-Alarcón G., Hidalgo-Bravo A, & Monroy-Muñoz I.E. (2023). Association of the EPAS1 rs7557402 Polymorphism with Hemodynamically Significant Patent Ductus Arteriosus Closure Failure in Premature Newborns under Pharmacological Treatment with Ibuprofen. Diagnostics, 13(15), 2558.

+ Open protocol

+ Expand

DNA Sequencing and BLAST Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR products were cleaned up with centrisep columns (Applied Biosystems, Foster, CA) and were directly sequenced with dye termination chemistry by means of the BigDye Terminator Cycle Sequencing System using an ABI PRISM 3130 DNA Analyzer (Applied Biosystems Inc, USA). DNA sequences were subsequent BLAST searching (http://blast.ncbi.nlm.nih.gov/).

Sámano-Hernández L., Y G., González-Márquez H., Corazón-Martínez L.A, & Lucio VM B.D. (2023). Human papilloma virus presence and its physical status in primary pterygium. Heliyon, 9(5), e16189.

+ Open protocol

+ Expand

PCR Amplification and Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR reactions were performed using 25–50 ng of genomic DNA, 300 nM primers, 200 μM dNTPs, 2 mM MgCl₂, and 1.25 units of AmpliTaq Gold (Applied Biosystems) in 1× PCR Buffer II (Applied Biosystems) in a volume of 50 μl. PCR products were purified with the Millipore Vacuum Manifold filter system and sequenced (BigDye Terminator v3.1 Cycle Sequencing Kit, Applied Biosystems) on the ABI PRISM 3130 DNA Analyzer (Applied Biosystems).

Li Y., Buijs-Gladdines J.G., Canté-Barrett K., Stubbs A.P., Vroegindeweij E.M., Smits W.K., van Marion R., Dinjens W.N., Horstmann M., Kuiper R.P., Buijsman R.C., Zaman G.J., van der Spek P.J., Pieters R, & Meijerink J.P. (2016). IL-7 Receptor Mutations and Steroid Resistance in Pediatric T cell Acute Lymphoblastic Leukemia: A Genome Sequencing Study. PLoS Medicine, 13(12), e1002200.

+ Open protocol

+ Expand

Identifying Genetic Cause of Recessive Inherited PCL

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To identify the genetic cause of recessive inherited PCL, we performed whole-exome sequencing on 2 affected (II-2a and II-3a) and 3 nonaffected members (I-1a, I-2a, and II-1a) of family A, and 1 affected (II-1b) and 2 nonaffected members (I-1b and I-2b) of family B (figure 2A). Genetic and bioinformatics analysis was performed according to the procedure as described.^{22 (link)– (link)24 (link)} Candidate mutations were validated by Sanger sequencing on an ABI Prism 3130 DNA Analyzer (Applied Biosystems). Within-family IBA57 variant segregation was analyzed using primers designed to amplify exons corresponding to the sequence under accession number NG_042231—PCR conditions, and primer sequences are available upon request.

Ishiyama A., Sakai C., Matsushima Y., Noguchi S., Mitsuhashi S., Endo Y., Hayashi Y.K., Saito Y., Nakagawa E., Komaki H., Sugai K., Sasaki M., Sato N., Nonaka I., Goto Y.I, & Nishino I. (2017). IBA57 mutations abrogate iron-sulfur cluster assembly leading to cavitating leukoencephalopathy. Neurology: Genetics, 3(5), e184.

+ Open protocol

+ Expand

Genetic Analysis of IRS1 PI3K-Binding Sites

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was isolated using a Macherey-Nagel extraction kit. Genetic analysis
of DNA covering PI3K-binding sites of IRS1 was performed by PCR. The following
primers were used: Primer 1/1 (forward, 5’ggaggtgg cagtggaggccgactgcc3’;
reverse, 5’cctcagggccgtagtagcag tc3’) Primer 1/2(forward,
5’ctggagcccagccttccacatc3’; reverse, 5’ccctgggcaggctcacctcctc3’). PCR was
performed in a total volume of 25 μL, containing 1x Qiagen Taqpolymerase buffer (Qiagen, Germany), 2 mM MgCl₂, 6 mM dNTPs, 0.5 μM
of each primer, 0.2 units Qiagen Taq DNA polymerase and 50 ng
genomic DNA. PCR conditions were 5 min at 94 °C, followed by 35 cycles of 94 °C
for 30 s, 58 °C for 1 min, 72 °C for 45 s, and one step of 72 °C for 10 min. PCR
products were purified using a PCR Purification Kit (Invitrogen Carlsbad, CA),
and the Big dye-terminator sequencing kit (Applied Biosystems, Foster City, CA)
was used during amplification. Sequencing fragments were analysed by using an
ABI Prism 3130 DNA analyzer (Applied Biosystems). Sequence chromatograms were
analyzed by Finch TV.

Gorgisen G., Hapil F.Z., Yilmaz O., Cetin Z., Pehlivanoglu S., Ozbudak I.H., Erdogan A, & Ozes O.N. (2019). Identification of novel mutations of Insulin Receptor Substrate 1 (IRS1) in tumor samples of non-small cell lung cancer (NSCLC): Implications for aberrant insulin signaling in development of cancer. Genetics and Molecular Biology, 42(1), 15-25.

+ Open protocol

+ Expand

Influenza Virus Genome Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viral RNA was extracted from the culture supernatant of MDCK cells infected with each virus by using a QIAamp Viral RNA Mini Kit (QIAGEN, Hilden, Germany). The first-strand cDNA was synthesized by using Uni12 primer [16 (link)] and a SuperScript III (Invitrogen, Carlsbad, CA, USA). PCR was carried out with Phusion High-Fidelity DNA polymerase (NEB, Ipswich, MA, USA) and primer sets specific for A(H1N1) virus to amplify the viral genes of the Japanese isolates and the CA04/09 virus from the synthesized cDNA. The primer sequences used are shown in Table S2. The PCR products were purified with a gel extraction kit (QIAGEN, Hilden, Germany) and sequenced with a BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, USA) on an ABI PRISM 3130 DNA analyzer (Applied Biosystems, Foster City, USA).

Mitake H., Yasuhara A., Lopes T.J., Tagawa-Sakai Y., Shimizu K., Ozawa H., Kawakami C., Morikawa S., Sugaya N., Watanabe T, & Kawaoka Y. (2020). Comparison of the Pathogenicity in Mice of A(H1N1)pdm09 Viruses Isolated between 2009 and 2015 in Japan. Viruses, 12(2), 155.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!