Megascript transcription kit

Primers included the sequence of the T7 promoter (TAATACGACTCACTATAGGGAGACCAC) followed by the following recognition sequences:
Primer pairs were used to amplify a PCR product from genomic DNA. PCR products were directly used in a transcription reaction with T7 polymerase using the MEGAscript transcription kit (Ambion). The reaction was placed in boiling water and allowed to cool to room temperature to promote annealing. RNA was extracted with phenol:chloroform, washed with ethanol, and resuspended in 0.1 M TE buffer.
Stage 2 embryos were dechorionated in 50% bleach for 2 min. The embryos were mounted onto glass slides and desiccated for 4 min using Drierite. Embryos were covered with a 3:1 mixture of halocarbon 700/halocarbon 27 oils and then injected laterally. Embryos were imaged 3 hr after injecting.

Synthesis of double stranded RNA (dsRNA) was performed as previously described [13 (link)]. Specific primers were designed based on the cDNA sequence of the RmAQP2 gene described in the R. microplus Gene Index Project [17 (link)] (Table 1). Two fragments of approximately 400 bp were amplified, one located at the 5′ and another one located at the 3′ of the RmAQP2 gene (Additional file 1: Figure S1). PCR products were cloned into pCR™II-TOPO® (Invitrogen), sequenced and used for in vitro transcription. The MEGAscript® Transcription Kit (Ambion) was used for the dsRNA synthesis following the manufacturer’s protocol. The two RmAQP2 dsRNA molecules were checked by electrophoresis on agarose gel, quantified by spectrophotometry and kept at −20 °C until used for tick injection.

To identify H19-binding proteins, H19 pulldown was performed as previously described [21 (link)]. Briefly, biotin-labeled H19 RNAs were in vitro transcribed with Biotin RNA Labeling Mix (Roche) and MEGAscript® Transcription Kit (Ambion) then further purified with RNA Clean & Concentrator-5 (Zymo Research). Human skeletal muscle tissues (Additional file 2: Table S2) and mouse skeletal muscle tissue lysates were prepared using the RIPA buffer with anti-RNase, protease/phosphatase inhibitor cocktails supplemented in the lysis buffer. The eluted RNA-protein complexes were denatured, reduced, alkylated, and digested with immobilized trypsin (Promega) for LC-MS analysis at the MD Anderson Cancer Center Proteomics Facility. In vitro RNA-protein binding assay and in vitro RNA pull-down coupled with dot-blot assays were performed as previously described [22 (link)]. Briefly, the RNA-capture beads were incubated with recombinant DMD (aa. 3046–3685) protein in binding buffer [50 mM Tris-HCl pH 7.9, 10% Glycerol, 100 mM KCl, 5 mM MgCl₂, 10 mM β-ME, 0.1% NP-40] for 1 h at 30 °C. Post proteinase K digestion, the RNA fragments were hybridized to the dot-blot with probes reverse complimentary to the human H19 sequence. Dot-blot probe sequences are listed in the Additional file 1: Table S1.