Sybr green reaction kit

Total RNA was isolated using the TRIzol reagent (Takara, Kyoto, Japan), and transcribed into cDNA using the PrimeScript™ RT Reagent Kit (Takara, Kyoto, Japan). Quantitative real-time PCR (qRT-PCR) analysis was performed on an MJ Mini™ Gradient Thermal Cycler Real-Time PCR machine (Bio-Rad, CA, USA) with the SYBR Green reaction kit (KAPA Biosystems, MA, USA). The following primers were used for real-time amplification: INPP4B (Forward 5’-GGAAAGTGTGAGCGGAAAAG-3′ and Reverse 5′- CGAATTCGCATCCACTTATTG-3′); NPM1-mA (Forward F: 5′-TGGAGGTGGTAGCAAGGTTC-3′ and Reverse 5′-CTTCCTCC ACTGCCAGACAGA-3′); SGK3 (Forward 5′-CTGAGATCTCACCATGCAAA GAGATCACACC-3′ and Reverse 5′-GGGGCTAGCTCACAAAAATAAG TCTTCT-3′); Ets-1(Forward 5′-GTCGTGGTAAACTCGG-3′ and Reverse 5′-CAG CAGGAATGACAGG-3′); β-actin (Forward 5′-TAGTTGCGTTACACCCTTTC TTG-3′ and Reverse 5′-TGCTGTCACCTTCA CCGTTC-3′). The mRNA expression levels were analyzed using the 2^{- ΔΔCt} method and expressed as a fold change.

Synthesis of cDNA from total RNA and subsequent PCR was performed with a Reverse Transcription Polymerase Chain Reaction (RT‐PCR) Kit (TaKaRa) as previously described 14. Real‐time PCR was performed with a SYBR Green Reaction Kit according to the manufacturer's instructions (Roche Diagnostics, GmbH, Mannheim, Germany) on a LightCycler (Roche Diagnostics).
The following primers were used for real‐time RT‐PCR: TMEM207, PPH12073A‐200 (Qiagen); GLUT‐1 forward 5′‐TGCTTGTGGATTGAGGGTAGGA‐3′; GLUT‐1 reverse 5′‐AAGTCTAAGCCGTTGCAGTGG‐3′; GAPDH forward 5′‐GAAATCCCATCACCATCTTCCAGG‐3′; GAPDH reverse 5′‐GAGCCCCAGCCTTCTCCATG‐3′. The samples were cultured in triplicate, and the expression of each target gene was analysed using the 2^(−ΔΔCT) method 24. The ΔCT values were normalized to GAPDH for each triplicate set in both the negative control (the siRNA‐treated group) and the three siTMEM207‐treated groups. Values for each of the three target genes were expressed as fold change relative to the ones of the control group (set to 1.0). Standard deviations were computed for the triplicate sets. In addition, Student's t‐tests were performed to determine significant differences among groups with P < 0.05 considered statistically significant.

cDNA synthesis from the total RNA and subsequent PCR were performed using an RT‐PCR kit (Takara) as previously described.
²⁵ (link) Real‐time PCR was performed on a LightCycler (Roche Diagnostics GmbH) using the SYBR green reaction kit (Roche Diagnostics) according to the manufacturer's instructions. The following primers were used for real‐time RT‐PCR: IZUMO2‐forward 5′‐ CCGCCATGCCTCTGGCTTTGACCCTTCTGC‐3′; IZUMO2‐reverse 5′‐ CTC CAT GCCCATCAGCACGGCCCCGGCGCG‐3′; GAPDH‐forward 5′‐ GAAGGTGAAGGTCGGAGTC‐3′; GAPDH‐reverse 5′‐GAAGATGGTGATGGGATTTC‐3′.
The expression of each target gene was analyzed using the 2^−ΔΔCT method described by Livak and Schmittgen.
²⁶ (link) The ΔCT values were normalized to that of GAPDH in both the Trilencer‐27 Universal scrambled negative control siRNA‐treated (control) and si‐IZUMO2‐treated groups. The values for the si‐IZUNO2‐treated group were then calculated for each target gene as the fold change relative to the control group (control; set to 1.0).

cDNA was synthesized from total RNA, and polymerase chain reaction (PCR) was performed using a reverse transcription PCR (RT-PCR) kit (Takara, Seta, Japan) 12 (link). The procedure was performed according to the manufacturer's instructions. Real-time PCR was performed using the SYBR Green reaction kit (Roche Diagnostics, GmbH, Mannheim, Germany) in a LightCycler (Roche Diagnostics) according to the manufacturer's instructions. The following primers were used for real-time RT-PCR:
ERp57/PDIA3-forward 5′-TTGATTGCACTGCCAACACT-3′;
ERp57/PDIA3-reverse 5′-AGTTGCTGGCTGCTTTTAGG-3′;
GAPDH-forward 5′-GAAGGTGAAGGTCGGAGTC-3′;
GAPDH-reverse 5′-GAAGATGGTGATGGGATTTC-3′.
The expression of each target gene was analyzed using the 2^-ΔΔCT method described by Livak and Schmittgen 21 (link) using the LightCycler system. The ΔCT values were normalized to GAPDH in both the Trilencer-27 Universal scrambled negative control siRNA (control) and si-ERp57/PDIA3-treated groups. The values for the si-ERp57/PDIA3-treated group were calculated for each target gene as the fold change relative to the control group (set to 1.0).

Three, six and twelve hours after applying interventions, total RNA (n=5) was extracted by dissolving the PDLtm using TRIzol reagent (Invitrogen, Carlsbad, USA). The quality and integrity of extracted RNA samples were validated before their use. Real-time PCR was performed with a SYBR Green reaction Kit (Roche Diagnostics, China) in a LightCycler according to the manufacturer’s instruction to investigate the mRNA expression of RANKL, OPG, and Nuclear factor of activated T-cells (NFAT) C2. GAPDH served as the internal control. The sequences of relevant primers were shown in Figure 1.
Figure 1

cDNA synthesis from total RNA and the subsequent PCR were performed using a Reverse Transcription Polymerase Chain Reaction (RT-PCR) Kit (TaKaRa, Shiga, Japan) as previously described 17 (link). qRT-PCR was performed using a SYBR Green Reaction Kit according to the manufacturer's instructions (Roche Diagnostics, GmbH, Mannheim, Germany) on a LightCycler (Roche Diagnostics).
The sequences of the primers used in this study are as follows: for CTRP6 forward, 5′-ATTCCTGCTTCCTCTTGTGTTT-3′, and reverse, 5′-GACAGCCTTTGGGGAGATG-3′; for α-sma forward, 5′- GACAATGGCTCTGGGCTCTGTAA -3′, and reverse, 5′- CTGTGCTTCGTCACCCACGTA -3′; and for GAPDH forward 5′-GAAGGTGAAGGTCGGAGTC-3′, and reverse 5′- GAAGATGGTGATGGGATTTC-3′.
The expression of each target gene was analyzed using the 2^-ΔΔCT method 18 (link) embedded in the LightCycler system. ΔCT values for each gene of interest were normalized to the GAPDH values for each triplicate. Standard deviations were then calculated for each triplicate, and the fold change for each of the three target genes was recorded. The value for each of the groups (n = 3) was calculated as the fold change relative to the mean value for the control siRNA-treated group (control set to 1.0).

Extraction of total RNA and synthesis of cDNA were performed with RNeasy Mini Kit (Qiagen, Valencia, CA) and Reverse Transcription Polymerase Chain Reaction (RT‐PCR) Kit (TaKaRa, Shiga, Japan) as previously described (Takao et al., 2017). Real‐time PCR was performed with a SYBR Green Reaction Kit according to the manufacturer's instructions (Roche Diagnostics, GmbH, Mannheim, Germany) on a LightCycler (Roche Diagnostics).
The following primers were used for PCR: JAG2, forward 5′‐TACCAACGACTGCAACCCTC‐3′; reverse 5′‐GCACTCGTCGATGTTGATGC‐3′; GAPDH, forward 5′‐GAAGGTGAAGGTCGGAGTC‐3′; reverse 5′‐GAAGATGGTGATGGGATTTC‐3′. The expression of each target gene was analyzed by the 2^–ΔΔCt method.(Livak & Schmittgen, 2001) using the LightCycler system. ΔCT values of genes were normalized to that of GAPDH for each triplicate set. The expression ratio of tumor tissue to nontumorous tissue, T/N, was calculated.