Dynamo hs sybr green qpcr kit

Real-time qPCR was performed in the Bio-Rad CFX96 Touch cycler (Bio-Rad, Hercules, USA) using the DyNAmo HS SYBR Green qPCR kit (Thermo Fisher Scientific). Primer sequences for 16S rRNA, hla and regulatory genes are available upon request. For expression analyses, expression levels of each gene were calculated as 2^−CT, normalized to those of 16S rRNA and expressed as fold over that of the S. aureus 1800T isolate.

Real-time qPCR was performed in the Bio–Rad CFX96 Touch cycler using the DyNAmo HS SYBR Green qPCR kit (Thermo Fisher Scientific, Waltham, MA, USA). Primer sequences for virulence genes are available upon request. DNA and cDNA samples were diluted 10–100 times prior to amplification. For virulence gene expression analyses, the expression levels of each gene were first normalized to that of 16S rRNA for each sample and run. Thereafter, expression levels were expressed relative to that of the C. jejuni 11168 reference strain. For each isolate, four biological replicates were available and one to two qPCRs were run for each replicate resulting in a total of six qPCRs per isolate. Results are presented as the mean for all replicates.

The amount of mNG encoding mRNAs was established with qPCR. Total RNA was extracted from exponentially growing cells expressing mNG-v2-sfTq2^ox, mNG-v5-sfTq2^ox and mNG-v6-sfTq2^ox. Cells were harvested by centrifugation, lysed by cryogenic pulverisation and RNA was isolated from the lysate by phenol–chloroform isoamyl alcohol extraction, followed by isopropanol precipitation^{37 (link),38 (link)}. The concentration of extracted RNA was determined with a Nanodrop machine, and equal amounts were used as the template for cDNA synthesis with the First Strand cDNA Synthesis Kit (Thermo Scientific), implementing the random hexamer primers provided in the kit for amplification. The cDNA functioned subsequently as a template for a qPCR, with primers amplifying part of the mng sequence. For normalisation, established primers amplifying idnT were used^{22 (link)} in the DyNAmo HS SYBR Green qPCR Kit (Thermo Scientific). Three technical replicates per cDNA reaction and three technical replicates per qPCR resulted in nine qPCR reactions per sample. Normalisation was done by subtracting the mean threshold cycle (Ct) of the three replicate qPCRs per cDNA for idnT from the mean Ct for mng of the same cDNA template (ΔCt method). Values are negative as the threshold cycles for mng were reached earlier than those for idnT.

The lipooligosaccharide (LOS) locus class was determined with PCR as previously described [25 (link)] using primers described by Parker et al [31 (link)]. For the isolates that remained unassigned to a LOS locus class after PCR typing a manual search for previously sequenced LOS locus classes [32 (link)] was perfomed.
Real-time qPCR for cdtA, B, C and 16S rRNA was performed in the BioRad CFX96 Touch cycler using the DyNAmo HS SYBR Green qPCR kit (Thermo Scientific). The 16S rRNA primers have been previously described [33 (link)]. Primers for cdt genes were GGCGATGCTAGAGTTTGGC and GAACCGCTGTATTGCTCATAGG (cdtA), CGCGTTGATGTAGGAGCTAA and GCTCCTACATCTGTTCCTCCA (cdtB), and CAACAACTTCAGCTGTGCAAA and GGGGTAGCAGCTGTTAAAGGT (cdtC).

HDF-TERT cells were incubated with IFNs or left untreated for 24 hr, followed by adenovirus infection at 37°C for 1 hr at the multiplicities of infection indicated in figure legends. Nuclear DNA and total cell DNA were purified at 6 and 48 hr post-infection, respectively, using a QIAGEN DNeasy Blood & Tissue Kit. Both viral and cellular genome copy numbers were determined by qPCR using primer pairs that recognize either the Ad5 genome or cellular GAPDH gene with DyNAmo HS SYBR Green qPCR Kit (Thermo). The relative viral copy numbers of each time point were normalized to GAPDH. The fold-increase of viral copy number was calculated by normalizing to input viral DNA in 6 hr post-infection samples. Relative viral replication efficiency in IFN-treated cells was presented as the relative value compared to untreated cells. In the case of infection in A549 and NHBEC cells, nuclear and total DNA was harvested at 2 and 24 hr post-infection, respectively.