DNA isolation was performed using Genomic Mini AX Bacteria (A&A Biotechnology, Gdańsk, Poland) following the manufacturer’s instructions (https://www.aabiot.com/pobierz?code=15de0a1fe3fd35e7688cf0fe68a91af304ece5d2 ; accessed on 4 March 2023). To determine whether a given strain belonged to tuberculous or nontuberculous mycobacteria, multiplex PCR was performed (Table 1 , Table 2 and Table 3 ), as previously described [16 (link)]. In this method, two pairs of primers were used, which allowed for the simultaneous amplification of two different DNA fragments [18 ]. The primers were constructed by the European Union Reference Laboratory for bovine tuberculosis in Madrid and synthesized by Eurofins Genomics company (Eurofins Genomics, Ebersberg, Germany).
Genomic mini ax bacteria
Manufactured by A&A Biotechnology
Sourced in Poland
The Genomic Mini AX Bacteria is a lab equipment designed for the extraction and purification of genomic DNA from bacterial samples. It utilizes a rapid and efficient spin-column procedure to isolate high-quality DNA suitable for downstream applications such as PCR, sequencing, and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Miseq platform, by Illumina (2 mentions)
Lyticase, by A&A Biotechnology (1 mentions)
Ampure xp beads, by Agilent Technologies (1 mentions)
Q5 hot start high fidelity 2 master mix, by New England Biolabs (1 mentions)
Nextera xt index kit, by Illumina (1 mentions)
16s metagenomic sequencing library preparation part 15044223 rev b, by Illumina (1 mentions)
Anty inhibitor kit, by A&A Biotechnology (1 mentions)
0.45 μm filter, by Sartorius (1 mentions)
6 protocols using genomic mini ax bacteria
1
Mycobacteria Identification via Multiplex PCR
2
Microbiome Profiling from Soil Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic Mini AX Bacteria+” (A&A Biotechnology, Gdynia, Poland) served for isolation of DNA from soil samples, while employing universal starters 1055F (5′-ACGGGCGGTGTGTAC-3′) and amplifying a fragment of the bacterial genes 16S rRNA and ITS. Detailed PCR settings were presented in our earlier papers [82 (link)]. Sequencing of genetic material on the basis of the hypervariable region V3–V4 of the gene rRNA and the ITS1 fragment was carried out on a sequencer Illumina MiSeq (Genomed S.A. Warsaw, Poland). Primers 341F (5′-CCTACGGGNGGCWGCAG-3′), 785R (5′-GACTACHVGGGTATCTAATCC-3′) (Bacteria) and ITS1FI2 (5′-GAACCWGCGGARGGATCA-3′), 5.8S (5′-CGCTGCGTTCTTCATCG-3′) (Fungi) were used for amplification of the selected region. Sequences of bacteria and fungi were deposited in the GenBank NCBI under the access numbers: https://www.ncbi.nlm.nih.gov/nuccore/?term=OP914644:OP916021[accn] (accessed on 4 December 2022), https://www.ncbi.nlm.nih.gov/nuccore/?term=OP897054:OP897145[accn] (accessed on 2 December 2022), https://www.ncbi.nlm.nih.gov/nuccore/?term=OP978693:OP979103[accn] (accessed on 14 December 2022).
3
Bacterial DNA Extraction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA was extracted from liquid culture and suspected colonies with the use of GenomicMini AX Bacteria commercial kit (A A Biotechnology, Poland) according to the protocol described by the producer.
4
Soil DNA Extraction and Metagenomic Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was isolated from the soil collected from the organic horizon (O, n = 3) and additionally from one sample from humus mineral soil horizon (A). DNA was isolated from 1 g of soil according to protocol of Genomic Mini AX Bacteria + (A&A Biotechnology, Poland). Mechanical lysis was carried out with zirconia balls in FastPrep-24 homogenizer. Additionally, lyticase (A&A Biotechnology, Poland) was used in enzymatic lysis.
Fungal DNA libraries were prepared for ITS1 rDNA region amplified with ITS1F33 (link)` and ITS2 primers according to protocol “16S Metagenomic Library Preparation” (Illumina). Bacterial DNA libraries were prepared for V3-V4 16S rDNA region amplified with 341F oraz 785R primers34 (link).
PCR was carried out in a reaction mixture that contained 15 ng of genomic DNA using Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs, USA). Indexing PCR was prepared using the Nextera XT index kit (Illumina). After indexing, the samples were purified with AMPure XP beads, verified with a Bioanalyzer (Agilent Technologies, US) and qPCR. DNA libraries were sequenced on the Illumina MiSeq platform (2 × 300 bp paired end) by Genomed (Poland). Sequencing depth was 50,000 reads per sample.
Fungal DNA libraries were prepared for ITS1 rDNA region amplified with ITS1F33 (link)` and ITS2 primers according to protocol “16S Metagenomic Library Preparation” (Illumina). Bacterial DNA libraries were prepared for V3-V4 16S rDNA region amplified with 341F oraz 785R primers34 (link).
PCR was carried out in a reaction mixture that contained 15 ng of genomic DNA using Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs, USA). Indexing PCR was prepared using the Nextera XT index kit (Illumina). After indexing, the samples were purified with AMPure XP beads, verified with a Bioanalyzer (Agilent Technologies, US) and qPCR. DNA libraries were sequenced on the Illumina MiSeq platform (2 × 300 bp paired end) by Genomed (Poland). Sequencing depth was 50,000 reads per sample.
5
Bacterial DNA Extraction and 16S Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Water samples (1000 ml) were vacuum filtered through a 0.45 μm filter (Sartorius, Germany) and bacterial genomic DNA was extracted using Genomic Mini AX Bacteria + (A&A Biotechnology, Poland), followed by DNA purification using Anty-Inhibitor Kit (A&A Biotechnology, Poland).
The amplicon libraries of the hypervariable V3-V4 region of the 16S rRNA gene were prepared according to the 16S Metagenomic Sequencing Library Preparation Part # 15044223 Rev. B (Illumina), followed by a two-step PCR using Herculase II Fusion DNA Polymerase Nextera XT Index Kit v.2. The sample libraries were loaded on an Illumina MiSeq Platform and 2 × 300 bp reads were generated by Macrogen (South Korea).
The amplicon libraries of the hypervariable V3-V4 region of the 16S rRNA gene were prepared according to the 16S Metagenomic Sequencing Library Preparation Part # 15044223 Rev. B (Illumina), followed by a two-step PCR using Herculase II Fusion DNA Polymerase Nextera XT Index Kit v.2. The sample libraries were loaded on an Illumina MiSeq Platform and 2 × 300 bp reads were generated by Macrogen (South Korea).
6
Bacterial Identification via 16S rRNA Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The identification of the isolates that exhibited antagonistic activity against selected pathogenic bacteria was executed by sequencing of the 16S rRNA gene. The DNA was isolated using Genomic Mini AX Bacteria+ (A&A Biotechnology, Gdynia, Poland) according to the protocol purchased from the manufacturer of the kit.
The PCR amplification of the targeted gene was determined with a pair of primers:
rP1 5′ CCCGGGATCCAAGCTTAGAGTTTGATCCTGGCTCAG 3′
Fd2 5′ CCCAATTCGTCGACAACACGGCTACCTTGTTACGACTT 3′
The amplified products sequencing was carried out by Macrogen (Amsterdam, the Netherlands). The purification of the amplified gene coding for 16S rRNA was executed using the enzymatic Post−PCR Immediate Cleanup (EPPiC) purification kit (A&A Biotechnology, Gdynia, Poland) following the protocol provided by the producer.
The PCR amplification of the targeted gene was determined with a pair of primers:
rP1 5′ CCCGGGATCCAAGCTTAGAGTTTGATCCTGGCTCAG 3′
Fd2 5′ CCCAATTCGTCGACAACACGGCTACCTTGTTACGACTT 3′
The amplified products sequencing was carried out by Macrogen (Amsterdam, the Netherlands). The purification of the amplified gene coding for 16S rRNA was executed using the enzymatic Post−PCR Immediate Cleanup (EPPiC) purification kit (A&A Biotechnology, Gdynia, Poland) following the protocol provided by the producer.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!