Specific primary antibody

Cellular extracts of 1 × 10⁶ cells were homogenized in the RIPA lysis buffer in the presence of proteinase inhibitor cocktail (Roche), and the protein levels were measured by bicinchoninic acid assay protein assay kit. A total of 20 μg of protein was loaded onto a 10% sodium dodecyl sulfate polyacrylamide gel for separation by electrophoresis and the protein bands were then transferred to a polyvinylidene difluoride membranes (ImmobilonP-SQ, Millipore). The membranes were blocked with 5% albumin diluted in Tris-buffered saline containing 0.05% of Tween 20 for 2 h at room temperature and incubated with the specific primary antibodies (Cell Signaling Technology), to detect pro-caspase-1 and cleaved-caspase-1, after overnight incubation at 4 °C. After washing, membranes were incubated with secondary antibodies (IRDye^® 800CW Goat-anti-Mouse and IRDye^® 680LT Goat anti-Rabbit IgG Antibody, LI-COR, Lincoln) for 30 min at RT. The protein bands were visualized by digital fluorescence (Odyssey^® CLx Imaging System), and protein density was analyzed by the ImageJ software. All the data were normalized by β-actin expression quantification.

The protein expression levels of p-ERK, p-AKT, p-GSK3β, IRS-1, PTEN and GLTU4 was detected by western blotting. First, 2 μg tissue lysates were loaded on each lane of 10% polyacrylamide gel, and then blotted onto a polyvinylidene difluoride (PVDF) membrane. After blocking with a PBST containing 5% nonfat dry milk, the membrane was incubated with specific primary antibodies (Cell Signaling Technologies, USA). Peroxidase-linked IgG (Life Technologies) were used as secondary antibodies. These proteins were visualized with an ECL western blotting detection kit (Amersham Biosciences).

Leukemia cells (HL-60, NB4, THP-1 and U937) were seeded in 24-well plates at 5 × 10⁵ cells/well in which E5 was added at different concentrations for incubation of 24 h. Collected and washed with PBS, cells were lysed in RIPA lysis buffer (Beyotime Biotechnology, Haimen, China) supplemented with protease inhibitors (Sigma-Aldrich, USA) on the ice for 30 min. The lysates were clarified by centrifugation at 15000 rpm for 10 min. Equal protein (30 µg) was loaded and separated on 12% polyacrylamide gels (Applygen, Beijing, China), and transferred to PVDF membranes (0.2 µm; Millipore, Bedford, MA). Cleaved caspase-3 and β-Actin were probed with specific primary antibodies (Cell Signaling Technology, Beverly, MA) and secondary antibodies conjugated to HRP (Zhongshan Goldenbridge biotechnology Co, Beijing, China). The immunocomplex on the membrane was visualized using Image Quant LAS 4000 (GE Healthcare) with Immobilon ® Western HRP Substrate luminol reagent and peroxide solution (Millipore, Billerica, MA).

Cells were divided into the following five groups for western blotting: control group (untreated RAW 264.7 cells), model group (RAW 264.7 cells treated with ox-LDL), and three treatment groups (RAW 264.7 cells treated with ox-LDL and 0.2, 0.6, and 1.8 g/L of GXHP, respectively). Cells were collected, and a protein extraction kit (Gene pool, Beijing, China) was used to extract proteins according to the manufacturer’s protocol. The protein concentration was determined using a BCA protein assay (Multi Sciences, Hangzhou, China). Protein separation using 12% SDS-PAGE gel was then performed, and the protein samples were transferred to a PVDF membrane. After blocking, the PVDF membrane was incubated with specific primary antibodies (Cell Signaling Technology, Danvers, MA, USA), such as PI3 kinase p85 antibody (dilution ratio was 1:500), phospho-PI3 kinase p85 antibody (dilution ratio was 1:1,000), AKT1 antibody (dilution ratio was 1:1500), and phospho-AKT1 antibody (dilution ratio was 1:500), overnight at 4°C. This was followed by 1 hour incubation at room temperature with horseradish peroxidase conjugated goat anti-rabbit IgG (Abcam, Cambridge, MA, USA)(dilution ratio was 1:5000).Antigen–antibody binding was detected using enhanced chemiluminescence reagents (ThermoFisher Scientific, Waltham, MA, USA). Quantification of each protein was determined using Quantity One v.4.6.2.

OVCAR8 cells (500,000 cells/well) were plated on a 6-well plates. The cells were then treated with 5 μM gold compounds and incubated for 24 h and 48 h at 37 °C, after which media was removed and cells were washed with PBS. The cells were scraped into SDS-PAGE loading buffer (64 mM Tris-HCl (pH 6.8)/9.6% glycerol/2% SDS/5% β-mercaptoethanol/0.01% bromophenol blue) and incubated at 95 °C on a heat block for 10 min. The samples were cooled and stored at −20 °C until ready for use. Whole cell lysates were resolved by 4–20% sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE; 200 V for 25 min) followed by electro transfer to a polyvinylidene difluoride membrane, PVDF (350 mA for 1 h). Membranes were blocked using 5% (w/v) bovine serum albumin (BSA) in PBST (PBS/0.1% Tween 20) and incubated with specific primary antibodies (Cell Signaling Technology and Santa Cruz Biotechnology) overnight at 4 °C. On the following day, after washing with PBST (3 × 5 mL), the membrane was incubated with horseradish peroxidase-conjugated secondary antibodies (Cell Signaling Technology) in fresh BSA blocking solution. Immune complexes were detected with the ECL detection reagent (BioRad) and analyzed using a BioRad imager fitted with a chemiluminescence filter. Intracellular ROS using murine polymorphonuclear neutrophils.

Another experiment was set up in similar conditions, protein and total RNA was extracted for western blot and quantitative real-time PCR respectively, using TRIzol reagent (Invitrogen, Grand Island, NY, USA) [43 ]. 25μg protein for each lysate was subjected to SDS-PAGE as per our standardized protocol [43 , 44 (link)] with specific primary antibodies (Cell signaling, Danvers, MA, USA) for phospho NF-κB p65 (Cat.#3033), total NF-κB (Cat.#8242), TrkA (Santa Cruz Biotechnology, Dallas, TX, USA, Cat.# sc-118), p75-NTR (Cat.# 2693), α-tubulin (Cat.#2125), and bands were analyzed using Image J software (NIH). Real-time PCR was conducted with extracted total cellular RNA using SYBR green (Qiagen, Valencia, CA, USA) and specific primers for IL1B (Forward: 5’TTCGACACATGGGATAACGA3’ Reverse: 5’TCTTTCAACACGCAGGACAG3’), CASP1 (Forward:5’TACAGAGCTGGAGGCATTTG3’ Reverse: 5’GATCACCTTCGGTTTGTCCT3’), NLRP1 (Forward: 5’TGCCTCACTCCTCTACCAAG3’ Reverse: 5’AATTCCTGACGTTTCATCCA3’), NLRP3 (Forward: 5’GAAGAGGAGTGGATGGGTTT3’ Reverse: 5’CGTGTGTAGCGTTTGTTGAG3’), and RN18S1 (Forward: 5’ TCAAGAACGAAAGTCGGAGG3’ Reverse: 5’GGACATCTAAGGGCATCACA3’). Analysis of relative gene expression was performed as described in earlier publications [43 , 45 (link)].