Mir 150 5p mimic

The human CRC cell lines (HCT116, HCT8, HT29, SW620, SW480, LOVO), and normal colonic epithelial cells (FHC) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). All the cells were cultured in DMEM (Gibco, USA) containing 10% fetal bovine serum (FBS, Gibco, USA), 0.1% penicillin-streptomycin (Gibco, USA), in a humidified incubator under 37 ʹ and 5% CO₂.
miR-NC (UCACAACCUCCUAGAAAGAGUAG), miR-150-5p mimic (UGGCAGUGUCUUAGCUGGUUGU) and miR-150-5p inhibitor (UCUCCCAACCCUUGUACCAGUG) were purchased from Guangzhou RiboBio (Guangzhou, China). SW480 and HCT116 were transfected with 2 µM miR-NC, 2 µM miR-150-5p mimic and 2 µM miR-150-5p inhibitor using Lipofectamine 2000 (Invitrogen, CA, USA) according to the manufacturer’s instructions. Briefly, cells were seeded in 6-well plates at a density of 5 × 10⁵ cells/well. 24 hours later, 2 µM of each molecule was added into 100 µl Opti-MEM® I Reduced-Serum Medium (Invitrogen, CA, USA), and then 6 µL Lipofectamine 2000 reagent was added for 10 min incubation at room temperature. The mixture was added to cell culture dropwise, and the transfected cells were subjected to subsequent analysis 48 hours post-transfection.

The circLOC101928570 overexpression plasmids and empty vector were constructed and designed by GeneChem (Shanghai, China). The miR-150-3p mimics, miR-150-5p mimics, miR-150-3p inhibitor, miR-150-5p inhibitor, miRNA mimics NC, and miRNA inhibitor NC were chemically synthesized by Riobio (Guangzhou, China). The pCDH-CMV-MCSEF1- GFP + Puro (CD513B-1) vector was used as a negative control plasmid, and the pCDH-MYB plasmid was fragmented and inserted into the pCDH-CMV-MCSEF1-GFP + Puro (CD513B-1) vector with BamHI and NotI restriction sites. The vector construction results were verified by direct sequencing. The sequence used was 5 ‘-CCGGAATTCCGGGAAAGCGTCACTTGGGGAAAA-3’. PLKO.1-puro (Addgene plasmid # 8453) was used to design short hairpin RNA, and the cells were transfected with Lipofectamine 3000 (Invitrogen, United States). The transfection process lasted 48 h.